Description :
From Genome Similarity Track
Location :
scaffold_48:56729- 58375
Sequence
1646 bases(100 bases per row)
GAGCATGTATTGTGTTTTCTAATGGAAGCTCAGAGGGTCGGAACAACGCGATTCAGCACCACGGTAACTCTGTACAAGTACTCCAAAATTGTCCCCCGAC
ACGCGATTAGCGCGTTCCATGTAACCATATTTCTGTGGATGGTCGGCGATAGCACCTTAAACAAATTTACCACACTTTCTTTAAAGTGCGGTTCCTGACC
CGAAACAACGGTCACCGGCAAGCCGTGTTGGCGAACACACATTCTCGGGGATCTGGTTGGCTGTATCCTCATCAGTTACGGCATcgttgacagcagcgag
aagGGCCATTTAGCTCAGACAGCCCATAAAGACGACACTGTCGATATTACTGGAGGTGCCTTTTGAAGGACCATAATTAGAGTCTATGCTTATGGAGTAC
CTGCACTACCGAACGGAAAGCCTATCAAACGGCACCAACAGATGCAGAAAGGGTTTTGTCTGCCGACAGTTTGTACACTCTACCCATTTATTCATTTTGG
TCCACCAGTACACGTTTATGCGCCTCGAAATGTTCTGTTTACTTGATGTCGTCATCATAAGATGCTACCCCACGTTGAGTTAGTGCTAAGAAACATCAAA
CGTTGGGATAAGGATAGCAAGCGCGCAGTCAATTACTTTGATATAGCGGCATCAGTGTTTAAAAACTTGCTCCCGAAAGCAGCGAAACACAAGCTGCGTC
GGACCCGTAAGCTATACATTTCACTTTATAGATCGTCGAAATTATCAATGCAATATGCGACAGCTTGCAATAGCACAACCACCACACAAAGCCAAACCAG
CTTATTAGTTTACCCGATTGGCAGCGATATAAAACCATTTTATCATTCTTTGCGATAGACGTGGTGACGCCGTCATGCTCAACGACGCAAACTGTGTACA
AAACATGAATGGCTTCGAGCTCAGTAGCTGTCCCTAAACCTGACCAAGATATACTTCATTGTCAGAAGATCTGTGTCATAAAAAGAATATTTCTTCATAA
CCACTACATACTCCAACGCGGTTGCATTTCGCGGCCTTTATCACTTGCTTGGCCTAAATCACATTCTGTGGCAAAATTTAACCGTCATAAATATTAATTA
ATGATGGGCCTGGACTCAAAAGAGAATTGGGGTACACACGAGTCTTTCTTTGACTGGATTGGAACCCGCCTCTTTTGCCGGACCTTCGTATCATGTAACA
TCTTTAAAGACAATTAGTGAGGGGCCGTGTCATCGTGATATTGTTTGCACTATTCGTGTAATTAGATCGTTAGGGAAACCACTTCCTTAAGTCTTCCCGA
GACTAACGTACCGGCCTATCTACAAATGCATTACCTTTGCTGGATGTGCCGACAGACCATGCTTTCTAATGATTTAACTCGGAGTGACAATTTTGTCAGT
GCAAAAGAAATACTGTTCTTTAGTTAAGAGTGGCTCGTATAAGCGCATATCCCGAAGCACAGCTCACTAGCGTTAATATGGCTCTCGCCATTCGACTTTG
CGTGCTCTGCAACACTATAGACGAATACACAGTCAAAGTGGGTTTGCGCGTAGACACGATGTGGCTTGAGCAGTTGCGTCATGTGACGATCGATTATGCT
AGTTCGCTAGTAGGTCTTTGTGGCATAATAGCCACTCTTAAAGCGT