Description :
From Genome Similarity Track
Location :
Scaffold_156:56714- 57885
Transcript NameFunction/comments
Phypl_g4384hypothetical protein

Sequence
1171 bases(100 bases per row)
GGGCATAAGCTGGCCTCAGATACGTGGGTGAAGTTTTCGCCTGCACTACGTGCAGATCCTGGATACTGCCTCACATGAGACGTTTTCCTGTTGAAGTTGA
TTGTTCTAAGCGGTCGTGTCAATTGACACTGGACCAGCGTCACCCACGCGGCGAGGCTCATTCCTCAATTTGCCAAGACCCATCAGCGGCACCAGGGAAA
CAGCGCCATGTTCGGCCACCCGCACTCGCCTCCGCACAGCCCGCCGCACCACCATCACGGCCCCCCTCCTGGCCACCACAGCCCGCCCCCTCCTGGCCAC
CACAGCCCGCCCCCTCCTGGCCACCATGGCCACCATGGCCACCACAGCCCTCCGCCGCCCGACCACCATCACGGACCGCCGCCGCACCACCACAGCGCGC
CTCCGCCACGTGGCTGGTAAGCTCGGCTTCAAGCAGAAGACAAACGGAAAAACGTGGAGCTTCTACTGTTGCCACCATAAATATACGTGACCTTCTTCAC
CTGTAGCCTTCATGGTCTTTCATCTGTTGCTTACGGCCAAGGTCTCAAGTTGAGACTCTCAACCATAgcggaggccaagcgccagctctgcagcatcgaT
CAAGCGCACGTCATGCTTTGGTAGATCAGGTTTGGCACAAAAACGTCACGGGGCTGGATTATCAACACGCGCTTGCAGTAGCTGCGCGTCGCATGAACAT
CCCGCTCCGTGGGGCTCTCCTGCCGCTGTGACAGCGCGCTTCAAGATCTCCCGGCTCGCCTCGCAACCGCTGCATCATTTCACTAGGGCCACGATAATCA
CAACACATTTCGCCGCTTCGAGCTCACACAAGACTTCGGGTAAGCAGACTCAGGCAGAACCATGTATCGCGGATACCCAGGATCGCCGCGCGGAAGACac
ccaccgccgccgccgatggaGTGCCCGCccccacggccgccgccgtaTGGATATGGCCCCGGCTGCCCTCCGCCGGTGCCGTTCTCGCCGCCGCaccatc
atcatcatcacaGCCCTCCGCCTCCCCCAGTGTTCTACCCTCCGCCTCCGGACTACAACGGGGctccccctcctcctccggaACCTGGCTATTACGGAGC
TCCACCTTGCTCACCACCGccgcaccaccaccatcatcCCCCCCCGGGGTGGTAAAATGCGTGCGATGCGG