Description :
From Genome Similarity Track
Location :
Scaffold_3:567119- 570494
Sequence
3375 bases(100 bases per row)
TGCATTAATGCACAACGGGTGCAAAGTCGCTGGCATCACAGACCACGTGAAATGGCATGTCGTGGTCTGCAATCACCAAAACTGGCGATCGTATTAAGCT
TTGCTTGATACCTTCGAAAGAGCGCTGGCAGTCGGCACTCCATTCCCACTTCTCGTTCCTTTTTAATAAACGAGAGATCTGAACAGTCATCTCGGCGTAA
TTGTGCGAGTATTTGTGTAAATACGCCGCTAGGCCAAGGATCTTACGAAGTCCTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCACCTTGATCTTTT
CTGGATCGGGCCGAAGGCCTGCTTACCCACGATGCATCCAAGAAGTGGTATTTCGTTAGCAGCAAATATACACTTCTTGAGGTTGGCGTACAACTTATGC
TCGCGCATTAGTGTAAGAACTTTCTGAAAGGGTAGTCGGTGCACTCCCACATCCGTCTGTCCATCCATAGCCCGGCTATAGACGAACACATCATCGAAAT
AACTGGGCGCGAACTTTCTTACGGATCTTTAATAAATTCGTTACACATCTGTTAATTGTGGCAGGGGCATTAACTAGCCCTTGTGGCATTACTAACCACT
CCCAAAGTATACCGCTTTAGGTGCTCACTGCAGTATAGGGAATGTCCCTTTCGCGCATAAGAATCTGATAGAACCCATCCATCCATGGATGAAAAGATGG
TACTCTTAGCCATACCATCTATGATGACATCTTTCCTTGATATTGGTGAATAAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCG
CCATCCTCTTGTGGCCTTTCGGACACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTCAAATGGCCGGCTGCCAAGCGATCGGCAAAGAATTTG
TCAATCGCTAGTACTTGTTCACGAAGCAATGGCCATTGCTTTATGAAACAGTACTTTGAATCTGGTTTCAGGTCTATCTCGTGACGATTACCCTTATCCT
TGGGTACGGTACTGTTTCTGGGAACACATCCCTGAATTCAGTCAAATCATCGTAGAGAGGAATTGTCTTGAACGATTCCCACGATTGAGATGTGTATCGC
TCAATCCGAGTCTTTTCACCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTTGTTCTCAGCGAATACCATTGCCGACCGAATATCGGTTA
CGTACTCAACTTCCGCGACGAGTACGCAAATCTGCTTGACTTTACCACTACGCAGATCACACAAGAACCTTTTCTGCTCGAGCGTGGGCAATCGAGTGAT
CTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAAGCATATGGCTACGTATAATTCATCCGTCATTGACCAGGACATTTAATGTCTCTGTTGTCTCCTGG
GAACTTATTTCCACAGTTGGGTGGGGACATATTCCCTCACTAGCCTCTTGGGCTATCTCATCGTCTGACACGGGTGGAATTTATCCCTCGCTATCTTCTG
GAGGTGGTTGCGCTACCGCGGTCAGATCTTCTACGTGGGATTCTCCAATCGCACTAAGATCATCGTATTGCCAATCATTGGCAATCGGTTCATTTTCACT
TGGGTTTTGTCCGTTTGGAGGACACCCATGCCCCAGTCCACTCGACTTATTCGGGTAGTGGGCCTTTGGCGCGACCTGCATCTCAATGCAGTCGCCGGGA
TCTGACTTCATGGTGTGGCGATCAGCCACTCCATGGCCATGTGCAGTCGTACTAACGACCGAGCCACACATGAGGTCATCGCACTCGCTCGTAGTACACC
CACATGTTTGTGGGCGCTCCATGGCGTTCATCAGATGGCCATCTGATGAACAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGCTC
GTACCTTCTGAGCCAAGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAGTCCAATATGATGAAGTCATCATTGTATTGCACTTCTTTCAGTGTATAG
GTAATACTCACTACACGTTTCATCACTGTTACGGATACGCCTGTCGAGAGGTGCACCGTCATCCCCGTTGGAAGGATTTCTCGCTCAACATATTCGAGCT
CTCTTTGTCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGCCCCACAATCGACAAGGACTCGAAGCGACATGCCTTGTGTCACTTCGAGTTTCAAGGTA
ATGAGGAAAACCTCATTACCAGAAGCAGCAATACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCACTTGACGTTGCTGGAT
CAGTAGGGTGCTTCGCACCTACTGACCCTGACCGTTTTTAGGTCATCCGTTACGGTGTTGCGCTTTTGCAACAGCTTCGGACCCACGCCTCGGACCCTTC
TTGGCCGCTTGACAGTTACTATTTCCTGCGGTAAGTGGTACCGCGTTCGGCACTGCATTCGTTTGCATAATGCCCTGGTTTTTGACACATATTGAGTGTC
TGCAATTTCTTATAATTGTTAACGCGAGAGCTTTCACTCTCAGTGTAACAGAGTTCCATCGGTTATGGGCCTCCGCTTTCCTGTCGCCTCGGGGGACGAT
AGGAGTTTGAACTCACGTGAGCTTGTTTCACGCTGAAATCTTCTTGTTTCGCAACTCGGATTGCCTCTTCCAGGGTATCTAATTTGAACCGAAAGAGATA
GGTCCTGACTCGACCGTCTGTGAGACCCTGCATGAACATCGTGATCAACGTTTGTTCATTCGGCGGATTGGACGTGATGCAGCTCGTAAGATGACGTATG
TACTGAATGTACGAGTGTACATCACGTTTGCCTTGTTTGAGTTTCAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGTGGTTCGAATGTTTGACTAA
GCAGGGACTTGAAGACTTCTAACTACCCAAAGACAAATGGGTCTTGTAGCTTGAGGCCCTAGACCCAAGTCTTCGCACGCCCTGCCAAGTTCGACTGAGC
AAATGCGACCTGCATTTGCTTATCGACGATGTGAAAAGCCCTTATGGCTTCATCTATCCTAATAAACCATCTCAGCAGGGGATCTTATTTAGCTACTTTG
TATTTGGAGATGTCAATCTTCAGTGGTTCAGGTCGACGTGAGTGTGTCGACCCGGTGGCAGCAGCCTGCTGATTTCTCAACAACTCGAACTAGAGCAGAC
AGTATTGCACCTACGTCTTCTTGCCCTACCGTCGAACTCAAGCATTCGACAGCATCCCATTCGATTTGACTCAAATGTGAGTAGCTCTCGTGCGGTGGAT
GGAGGTATTTTGCTTCATCATCTAACATGTTCATAGTCGTTGGACGGACTACGAAGTGCTACAAGGAGTAACGGG