Description :
From Genome Similarity Track
Location :
Scaffold_871:5671- 8090
Transcript NameFunction/comments
g12188.t1XP_002896000.1 helitron helicase-like protein [Phytophthora infestans T30-4

Sequence
2419 bases(100 bases per row)
ACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCC
CGTCCTTCATGCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTC
AGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTC
TTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGG
CTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATC
AGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGTCCATATGAGATGAGGGCAGAATAACGAGGCGT
CCCACTTGGTTGAGAAATTGGGTATCACCACCTCGGCCTCGATCAGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTG
CTTCCAGCTGAATTGTACCTTCGTTAAGCAGTGCATCCTGAAGCCCTCGGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTG
CTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGG
AAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCAGTGTAGGTCCAACCCAGCTCCCCATACGGAA
GCAGAAGAGGGTATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCG
TCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGT
CGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGAGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCAC
AGGATCCAAGTCAGCAAAGATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCT
CCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTG
CATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGTTGTCGAAACGC
TGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTGGATTCGCCAGGC
CACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCCT
CATGGTTTGCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCG
TTCCGCATGTTGCTCTTGGTTTACCCCTCGCGCTTCGGCGCGTTCCTCCTGCGTAAGTTGTGATCGGCGCTGGGCATGTTGCTCCTGGTTTGCCATCCGT
TCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCCGGGCATGTTGCTCTTGGTTTACCATACGTTCTTCAGCGCGCTCCTCCTGCGTAAACTGAA
CCCGGCGGTCCGCGTGTTGCTCCCGGTCTGTCCTGCGCTCTTCAGTGCGATCCTGTACACTCCTGTGAAGCGCGCGAGAAGCACTGTTGCGTTCACGCTC
CGCGGCGTGGACCTCTTCGCTCAGATTATGCCGACGTTCCTGCTGTGCGATCCGGTTTCGTTCTCGTACGTCCTGAAGCTGCTCGGCACGGAGCTGGGCT
CGCCGGGCTAGCTTTCGCTCCGCGTCACGCCGCCGCGCACTCTCCCGCTGAGAGTCGGTCATGTTACTTCGTCTGGAACGCGCTCGCTGAGCCTCCCTCA
TCCGACGTGGATTTGCTTG