Description :
From Genome Similarity Track
Location :
Scaffold_24:56708- 59638
Transcript NameFunction/comments
g4769.t1RAW42778.1 hypothetical protein PC110_g1051 [Phytophthora cactorum
g4770.t1hypothetical protein
g4771.t1hypothetical protein

Sequence
2930 bases(100 bases per row)
CCTGCAACACTACGTCTTCTACGCCGAGAACAACCACTTCATGCTGCATGGAGGAGAGGCCAAGCCTTTCCTGCCAAAGTAAGACGAGGAGAAAGAAGCG
AGCAGTGACTGTGAACCACGAATATGAACTGATTTTTTTTTCAAGTGCCTCATGCTCGTTCCAAAAGTTGACGATGCGATCCACTTGACATGCGTTGCGG
CCTGCGGTAGTGGCGCTTTACACCAGAACCACGGCAAGGATTAAGACAACACTTTTGGCACTAATTGTCGAGCGTGAACTCGGAAAAAAGAGGCTGGGGT
TGCCAACCTTCGGGCTTTAAAGCAACACACGAAGCGATGGATGAATACTCGAGATTCGACTCAATTTTTTGTGGGCTACTACGAACTGCGTTATGACTGC
TATTCCAGCGGAAAGCTTATCCACAAACCTGTTACACTACTTCCACACTTTGCTGCGGCATCATTTCAACCTCCAATTGAGTTTCAGTGGTCAGCTCATA
CTTCCTCAACTGCATTTCATTGCCCCGAGTAGAGTCCGCTGCCAATGGTGCTTCAACAGTGGGGTCTCTCATTGAGGCGGGTCGTCGCTCGAGAATGAGG
TGAACTAGCTGGGGGTACCCGCTGAAATACGCCATCGACAACGCCGTCCAGCCGCAATAGTCCTCCAAATCTACGTTTGCATCCGCGTCCAATATGATGC
GAAGCGATTCTTGGCGATTGTACATTGCAGCCATTAAGAGGGCCGAGGCGCCAGTGTTAGATTGCCGGTCGAGGTCGGCACCTTGGTTCACCAGTACTTG
CACGACTTCATCATGGCCCATCTTGGCCGCAATGATGAGAGGTGTCACGCCGTCTTCACTGGGCTCGTTGATCGATGCGCCACCGCAAACCAGCGCCCGC
ACCATTTTGGCGAGACCCATCTCAGCTGCAACTCGCAGAGCTGTTGCCTGCCCAGGTCCTTTGGCATTGACGTTGGCGTTGTGTTCCAGCAGAAGGCAAA
CATTGTCGTAATGACCGTTAATCGCAGCACTCAGTAATGGGCTCCAACCTTCAGCGTCAGCCAAGTCTGCCGACGCTCCAGCATTTAGAAGTGTGGTCAC
AATGTTCACTGCTCCGAAGCTGCACGCAATTTTGAGAGCAGTACTACCGCACCACAGTTGAATATCGAGGTTGGCCTTGAATTTCACAAGAAGTTTCACC
ACGTCAGCATGGCCGTTCGCTGTGGCGATTGTCAACGGCGCGTAGCTGTCGCCTGCAAGCATGTTGATATCTGCGCCAGCTTCCAGTAATACTTGAACGA
CAGCGACGTGTCCCTCGCATGCAGCCACTTTCAATGCTGTAGAACCATGAGGTGTTTTCTCGTTGATGTTCGAATTGCGACTCAGTAGAACCCGCACGAG
GTCGTCGTAGCCAAGTTCGGCCGCGATGAGTAGAAGAGGCCAGCCCCTGGAGTCAATTGCGTTCGCGTCAGCTCCGTTTTGGAGAGCTCGATCAACATCG
GCAGCGTTTCCGTTCGTACATGCTTCCAGCAGATTGATCTCGACGCTCGACTTCATGCTTCGGTTAGTCATGTACGAGGTCACCGAGGCAAAGACTTGCT
TGATGTACGTCAACCAAGGCAACACCATCTTTTGTCGAATTCGTTTGTGTGTTGTGCTATTAGTACTACTCGATACGAGGACCTACTGATTTTTCGTCTC
TGAAATCCGGTCACTGGTAGTGAAATCAAGTCCAGATCACCTTATTGCCGAATGCTGTGGCATCGATAACGGGGGCGGTGCGAACGGCTTCACCATGAAT
GGACAAGAAACTGGGTAGACTGGTTGGGTGACGGGTGATGAGTACAGACTGTGCCCGGGTGCACTGGAATCCAATGCGTTTCATGCGTCCAGCTATTGCA
TTGAGCAATCTAGTTAGGTGAGCTCCTTGTTCGTGAAGACTTCTGCCCGTTTTAATATGTAAATTAGTGGTAAGTGTGTGTGTGTGTGTGGGGGAGGGGG
GGGCAATGTTCTACGCGTGAGCTATTCATTCTCGGCCGGAGAGTAAGGTCCTTCCTTTCTTGCCCACAGAAAAATAATCCTATGGATTCGACGACTGGAC
TTGCTCGTAACGATGGCTACGAATCATCTCCAAACGTGGACAACATTTACTTTCCGCTCCGGTGAACCCTGTGTACGGGTGTGACCTCGTCTGTAGCGTC
TGATCTGGGTTGTACCTACACCCAGAGGTGCACTCATGATGTACCTAGGCTGCAAAGTACTTCGAAGTATCTAGTTTGTAGCCATTGAGTAGTGAGTGTG
CATGTGGGGGCCAGCTGTGCTCGCCCCCGAGAAGACGAGAGATCAATGTCAGTTTCCATTTTTCTCCACAAAGCTTAAGTGGAAGTCGAGGAAGACAGAT
CAAAGTATACTTTAGTTCCTATCGGAATTGACTAGGAGACTATGTCGGAGGGAGACCAGTTCGTCGAGACATTTCGACGGCTGAGTCTCCGAGGAAGCAG
GGCAGCTGCAGCCAGGACGGAAGGAACGGGAGCCGAGAAGACGCGTCGGGTTTTGACGCCTATTGTGAACCCATTCGATGGTCGCCCTAGCCAGAGTAGT
ATCCCCCAAGCATCCCCGGCGAAGAGCGACGTGACGATGGAGGATGTGAGTGGTGATTTCGGGCCGGTAATGAACGCTCCGGCACTGCCTAAGCCCCCTC
GTTACAAGGGAAGCACCATGCAAGAGCGTCGGGACTTCCTACGGGCGTATAACACCTATTTTGCTGCGCTGAGAGCTTTCCAGACGGAGCACAATCGTCC
TTTTGTCCAACCCGTGGGTTCGTGCATCGAGCAGGGCACGAAGGAGATCATCGCGCGGTTCACGTTTGCAAAAGATTGGCAAGATGTGACCGAGGATGAG
TGGATTGCGTATTTCCTGCAGTCAAAGCAG