Description :
From Genome Similarity Track
Location :
Scaffold_1216:567- 2066
Sequence
1499 bases(100 bases per row)
GCGCCAAGACCGCGAAGACCAACTGGGGCGCCCGAAGTACGGCACTCGATGCTCACACTGCGGATCTCGCAAGCATACGGATCTCGGGTGCTGGAAGAGG
CTCACGTGCCAGAAGTGTGGACACATGGGCCATCCTACCGACAAGTGCTTCTACGTCTGCAAGTGCTGTGGAGACGTTCACGAAGCAGGTCAGTGTAAAA
TCGGCGACTTCTTCGATGCTGTTCGCCAATGGTACAACCCGACTCGCCATGCCGGACTGCTGTCCGAGAGCGTCGAGAAGGCGTTAAACTAGACCGCTCG
CCAGACCTGAACAGCCTGGTACGTGACGAGCGATCGAAGTTCTGCATTTATGCATATGTTCAGAGGAAGGCGCGAGCGTTAGAAGACCCAACTTCCTGTA
ATGCGGTGAATACAGCCAGACCTCTTACCTCGGATGAAGGTGACTATTCGCGTCGCCCTTGTGTGGTGGCCCTTCAACTGTCGCCGGGTGAACGCCGAGG
TTACTGGAAGTATTACACTCCCTCCAAGTGGTTCAAGCAGTCGAAGGCGACCGGTGCGGTCAACAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTGATCTCTACCG