Description :
From Genome Similarity Track
Location :
Scaffold_75:56689- 62850
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-snap-gene-0.27GK17193
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.16Myotubularin

Sequence
6161 bases(100 bases per row)
GAGCTGGTAGCAGCGCTGCTACGACGCCTAGCGAGTCTTCAGGTACCGTCAGGACAAACTGCAATGCGATTCTGTGATTCTTGCTCACATCGAAATTGTA
AATAGGAGCGAGCTCACGAACAGAACCCTCTCCAGGACAAGCGATCTCGACGTCTTGTGCTCGGGATGCACCAAGTGCGGCGAGGTGTCTTGCAGAACAA
AATCAGGTTGCTTATCATTGCGACGGACGTCGAAAGCGCGAGGCCTCTGGAGGATCAGATCGATGAATTCGCCGCCGAGGCGGAAAAGCAGAGCATTCCA
GTCGTGTTTCCCATGAATCGGCGAGTACTTTGACGATTTGAAGTTCCAGACAGAATCATCGAGCGTTGTGCTTACGCTTGGACATGCAGGAGGAAGCTGG
GGCGTGTGCTGAAGAAGGATGTCCGCGTGAGCTGCGTCGGTGTCTACTCGGTGGATGGCGCGAACGACCTGTTCCGAGAGCTCATGACACTCCTGTAAAG
TCCCAACAAGCTACTAATCGCGATCTCCAAGCTGCCAGTCCCGGAAGTACCGAGCAACATCGGCGCGGCTGAGCTGTTCGTTTCGGATAGCTGTTTTCCT
GTTCATACATCACTCGTAAGTCGTGGTGATCCTGGTATCCCTCGATAAAGCGGTGATTGATCACCTCTTGTTGGTAGCGCTGACAAATTCCAGGATTCGT
TGACATGCCGCGATCTGACTCAATGCGAAGCTGTTCACAATCGATGTCAAACTGAGTTTGGGAATTCGCTCAGAGACGATGTATCAGCTTACCTGTCGTT
CATTTCTGCCATGAACTCGAGGAAGCGCGCGTCGTTCGCAAGAGGCTCGCGGTTCAGCAACACAGCATTATTGGACCCAACGCAGGCTTCAAGCCGATTG
ACGAGCGCTTGAAGTGGCAGGTTTTCAACCCGCAGATTCCTCGCGACGATGTAGCGCTCCGAACTCGCAGGTCGACTCGTCTACATCAAGATCGGAATAC
CTGAGCAGCGGTTGCTTCAGTATCAAAACGAGCGTAACATACCACGGGCTTCACGACGGTGAGCTCTGCGAAGCTTTGATGCAGCAGCCACACGATCTCG
AGCATCGCAGGCGTCGCAAGTTCGAACGTCTTGCACACAAAGTCGCCGCCAGACCGAAGCACAAGAAACATGGCGAGTACCTCAGCCGCCACGAGCCGAG
TCATAATGGCTTCCTACAAAAAGGCATCACTCATCAGACAAAGGTGACACACCGATCCTCTCGCTCAACCCCAATCACCTGGTTGTCCAGATCGCGCGCG
TTGGGAAAGCCGCCGTCCGCCACCACGAGGTCGACGCCATTCGGATGGCGCTCCCGCACAGTGTCGCGGAAGCTGTGGACGTTCACGAGGTTGTACAAGT
CGCCGGTCCCGTCTGCTCCATAGCTGATCGCGAACGCCGCTGACTTGGTCGCTTCGGATGTTTCTCCGTCGATTACACCATCGACTGAGACGCGAGCGAG
GCCGGGTGGCAGTCTCCAGTCGCATCGAGTCGCGGCATCACGTAGAGAGATCCCAAACCCTTCAACTGGTCCACAAGCCTCGCTGCTATGTTTGTCAGTG
CACCGCCAGAGCAGGTACTCGCTGAAGCCTCCGGGTCCGCCGCAAATGTCCGCAAACGTCCACACCTCGCTCTCCTTGGACGCCCTCGTCCACCTAAACG
CGTGGTCCAGCGCCGCGAGTTTCATGGCTGACCGATTCACGAACCGGTGGCGACCGAGCGGCTCGAAGCGGTTGCACGCGCTCCTGGCGGAGCTAAACTC
AGCCGCGTCCAGAGGCTCGAACCGCTGCTTCTCGCACTCCAGCTCGGCCAGCAACTCGCCACTGCGTGGGTTCGAAATCTCTGCAGCGTCAGTCTCCTTT
GACTGTTGCAGCGCCTTTAGCACCACGTCGTGATCGTCGTAGTCGTTAACAAGGATCTTGATCTTGTGCGGACCAACAACGACCGAGTGCTTCTCCACCA
GTGAGCTACTGGCTGATCCCGCGCCTTGTGTGAGGGTCACGAGCTCGTCCGTCGCTGCCTCGCGGTCGACGCTGCGTCTCGCTCGCTTGCGCGGCGCTCC
GAAGCTCGAGAACCCCATGGCGCGCCGCAGTTCGTCCGCTTCATCGCTGCCGTCCATGTCTATGACCGGAAACAACTCGATCTATTGGCTCAAGAATTGA
CAGAAGCATACAAAGACCAAGACAAAACGTTTGAACTCTCGGCAGGCAGACCATGCTGTGGTATTGAACACTCGACATGCAACATGAACATGAGCCGGCG
GCGGGCGACGGCGGAGCGCGGGCGGGTATATATATTATACGAAATCTATCGCTCCACGCTCAAGGGCTCGCCGGGCGCGACGACCGCCGGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCCGGTGCAGCATCGAGTCGAGCTCGGCCTCGAGCTGCAGCTCGCGCGCGATGCTCTCGCTCAGCAGCT
GCTCGAGGTACTTGATACGGCTCTGGTCGGGGGCCATCTGCAGCGCCTCGCGGATGTTGCGACCCTGCGCGCGCTGCCGCGTGCGCTCCTCGGCCGCACG
CGCGAACCTCGCGAGCGCCTCGTCGTCGAACTCGCTCGCCACGTGGGCCAGCGCGAGCGAGTCGCGGTCGTCGCCCAGACTCGCCGCCATGTTCGACAGC
TCGCTCGTCAGCGCGTTCACCGCGCCGAACGCGCTCGTGACCGTCGGCGACGCGTCGAAGCCGTCCTCGTCGTCGCTCATGTCCGAGCAGTCGGACAGCG
TCAGCTTGCTGCGGAACTCGTCGTAGTCGTGGATGCCGTCGATCTCGAGCCGCAGCACCTTCTCCTCCGCGTCCAGGTCGCCACCGGCCTCGATCGGCAG
GATGGACGGCGACGCCATCGCGCCGGGACCGCCGCTTCCCCCGTTGCTGTTCATGCCGGACATCCCCAGATCCTCCAGCGACACGCCGCCGCGGCTCGCG
CCAAAGTCGCCCAGGTCGCTCGTGTCCGCCTCGTCCTCGTCCTCCTCGTCGTCGTCGTTCTGGCCCACGGGCTCCATGTACTCCATGTAGTCCGGGTGGC
TCTCGGGGTCCCACCGGAAGAACATGGCGTCCCACAGCACCACCCGCTTGAGGTTCGCGCGCGGGTACAGCACGCGGTTCGTCTGCCGGTACAGCGGGTT
CTTGAACGGCGCCGGGTGCTCCAGCACGGGCGTCCACACGCTCTCCGTGCGCTCCCAGACCTTGTCGAGGAACCGCTCGCGCTCCGAATTGTACAGGAAC
GTGCCGTACAGACCCGAGATGAGCGAGTCCGAGATGTGCAGCAGAAACTTCTCGTTGAACTCGAAGCACGTCGGGAACTGCCGCGTCATCTGCCACACGC
AGTCGAGGAACTGCATCATGACGGGCGACCGCTCGTTCGGCTGGTCCGTGATGTCCTTGCCCACGCCGATGCGGTCCGCGAACTTGTGCCCGAACGAGCA
CCACTCCTTCTCCACCAGCGCCGCGAACCCCCGGATGCTGCGGTAGTACGGGTCCAGGATCAGCTGCGCGAGCGCCACCATCTGCGGCGTGCGGTCCCAG
CCGTCGCTGCAGTGCACCAGCACCGACGCGCCGTCCTCGTGGAGCACCTCGGCCACGCGCCGCGCGCCAGACAGCACGCGCATCACGTGCTTCAGCCACC
GCGTGTCTGCACAATCGAGTCAACAAACATCACAGCCACCAGTCAGAACGGAATGATCCAATAGTGAAGACAGAGATGAAGGCTAACGCACTCTCGAGCC
GGTTGTGGTAGTGCTTGTCGCCGTCCTCGACGCTGCTGGGGCTCACGAGTGCTGCAGTGCAAGCAACGAGTCAGTCAAGTCAATAGAGACAGAGATAGAG
GAGTATCAGATGGACTCACACTTGAGCGCGTCCCAGGACTCGCGCATCTTGTGGATGTTGGCGATGCCCATGAACTCGATCTGCGCGTTGTCGTAGTGCT
GCGAGTTCTCGACGCCCTTGCCCTTGAGCCGGTTCCCCTTGGTCGCGATCGGCTTGCGCGCGTCGATGATGTGCAGCGGCGGCGACACGTTCGCGCTGTT
GCGGTTTGCTGAGTCGCGGTAGGCGCGCAGCAGGATGCGGTCCGGCTCGGACCGGTTGCCGGCCATGCCGTAGTTCGGCTGGCTCGACCGCGCGAGCACC
GACTTGTTCACCGGGTGGCGCCACACGACCACGGGGAGCCGCGCGCGCGACCGGAACCGCGCCGACTGCACGAGCTGCTCCTCCGACATGAGCGACGGCA
CGACCATGAGCTGCGGGTACGTGGGCGAGAAACGGAACTTGGAGTTCTTGAGCAGCCGCCACGTGATGGCGCCGTCCTTGTCCGGTCCCTTGTGGGCCGC
CAGGAACCCCAAACGCTGGTACTCGGCGAACGGCGAGTACACGAACCAGCCGTTGTTCTTCTCCGTGAGCGGCGCCGGCCGCTCCTTGGTCTTCTCCGTG
TGGTAGTCGAACGCGAACAGCGCGCCGATCATGTTGGGCGGCTTCATGCGCAGCGTGAGCAGGTTGAGCCACCGGAAGTCGGGCGTCGACGGCAACTGGT
CGTAGCCCTTCTTGCGCGAGTACGCGTCGTGCATGGCGAGCCGCAGCGTGCGCATGTCCTTGCACGTGATGAGCAGCATGAGCCCGTCGCGCGTGATGAG
GTCGATGGCCGCGAGCGGCAGCTCGAAGGAGCCGAACTTCCAGTTGGAGTCGTACGGCGTGAACGTGATGCGGTACGACGTGATCTTGAGCACGCCCTGC
ACGGCGCGGTCGCTCTGGGACATGACCACGAGGTTCGTCACGCGCTGCACGTGCTCGAGCACCGTCTCGCCCGGCAGCAGGCCGAAGTGGTCCGTCACGA
TCGAGTCGCGCAGCTTGGACCGCATAAAGTCGCTCGACGCCACCGACACGTCGTCCGCGATCTCGGTCGGCGCGCGCGAGTTGGCCCCAACACCACCTCC
GTTGCCATCACCGCCGCCGAGAGCCATCAGACCGGCCTCGGTCACAGTCGAACCGTTGACATTCGATGCACCGGCACTTCCACCGGCGTCCCGACCCGCG
GCCATGCTGCCTCCGCGAGTGATGGCCTTGGTGCTGTCGCCCTTGGCCACGCCGCGGTCCTTGCCCGTCGGCGGGTGGGCCGACGGCTTGGGGAACATGA
CCTTGCCCTCCTCCAGTGCCTGCACAAAGTTGGCGCGGTCCTCCGTGCTGAAGAACGTGATCTTCTTGTTGACGCTGGCGGCGCCCGTCTGGATCTTGAG
CTGCATGCCCAGCCTCGACTGCGGCTTGGCCGTCACGGCCGCGCACGAGTAGCTCTCCGGTGCGTCGTGCGGCGACAGGAACCGCAGCATGCGCGCGTCG
ATGTCCACCTGCAGCTGGATGGACGCGCGGCGGGACCCGAGCTTCTCCAGCACGCTGTCCGATTTCTTGACCGTGAACGTGAACAGCGTCAGGTCTGCCA
ATTGAGCATGGTCGCGCCCACCACCGACACCTCCGCCTAGCCCGAACAAATTGGCATGCGTCGACCGACTGCGTCCGTTCTCGGCCAATTGGTTGGCTGC
GATACCGGCATCATCAGCGGTCATCGGAGCCCGAGGAGGCGTTGCGAACGCGAGACCAGGCTTGTCGAACATGCCGACGGTACTGGGGCCACTAATCTGC
GACGAAGGGTACGCTCCAAGCGACGCTCGTCCTCCGTCCGCGCGTGGGATCGCCATGGGGAATCTCGGAGACGCTGCCTGTGTGAGGTCTGCGGACGCGG
GGGGGCCCCCGGCCCCCGTGGACGGCGCATGGTGGAATGACTGGCCGAGCTGCCTGCGGTTCGTCCGCGCGGCCGGGTTACTCGTCGCCGCGGATGGGTT
ACTCGTCCCCGCGGACGGGTTACTCGTCCCCGCGGACGGGGGGCCGGGGGACGGCGGACGGGGGGCCGAATCGGGGACGGCCGTGGATTGATCAGGGACG
TCGTCGGTTCCGTCGCCTTCGTTCGGGTTCATGCCGATGATCTTCCACGCGTTGGCCGTCGCCTGACCGGCCTGGAACAGGTGCTGCTCGGCCATTAGGA
GCTTATCAAGCGTAGCCGAGTCCATGGTTGACTGCCGCTGCGTCAGGTACGCGTCGTCCTC