Description :
From Genome Similarity Track
Location :
Scaffold_107:56680- 64341
Transcript NameFunction/comments
Physo_142024hypothetical protein
Physo_142025reverse transcriptase

Sequence
7661 bases(100 bases per row)
TCCCGCCGCCACTTGACGAGAGCCTCGTGCGAGAAACAGACAATCGGAGGTGGCTCCAACGCTGTCCATAGCTTGGTCGTCGGCTGCGACGTGTCACCGT
CATCTCCTGCGGTGTTCGCCCGACTGCGCTTCTGCTGGGGGCCGCTCATGGCCCGTGTTGGATCGTTGTCCACAGCCAAAGTTAACTTTGTAGTGTCTTT
CGACCCTTTGCTTGCTTGAGAATCTTTGCTTGGAGGTGAAATGAATTCTGGTATTCAATGCAGCCGCTGCGGCTTGCACCGCAGCGGTTTCTGTTAGTTT
CTCTTTGCTATATGTCTCCTTACTATGCAGTATACAATTGCTCTGAGAGTTCGCCCCGCTCTCATGCTTCTTCATGTCGTTGATAACGACCGTGCGAAGT
GTCTGCTGAAGGCAGCCTGTCCCAGGCCGCCACTACAAACATGGTGAAGCCCTTCTTCGAGACTTCCATGTCGGAGAACCCCAAGGTGTCTCCGGTCGAC
AAGAAGTGCAAGAACAAGAGCTTCGACGCAAAACTGAAGAAGCTCGACGAGCTGGAGAAGTCGAAGGGGACAGTCTTCGCGAGGGATTTGTCGGAAGGGC
GCAGAGGTTTCAGTGTCCACACAGCAGGCCCTCCGACAATTCGACTGCAATGAAATTTAAGTAAATCAACAAAGTAACTAATTGTAGGGAAGTTCTTGGT
ACGGATACATACAATATTCCTGCTGACCGCGCAATATCGTACCACTACGGCCTGCATCTCACTTTGTAGCGTTCACTGCGTCTGCTAGCGTCTTCACACC
CCACAGCTGGCGGTTCACCTTGAGGAAAAGAATGGTCTCCAGGTGAATCCTGCGGGAATTCGGAGGCCTACAAAGTGTTAAGACAGCAAGCCGAGATTTA
TAGTACAGCAGGGGGTACAAAATAATGTTTTACGGTACTCGACGTCTGAGGTTGCAAAAAAATAAATAATTCCATACAAATATTGCAGTAGTATTTCCAC
TTCAATGTATTATTCGGAGGGCCTACCACACAGTGATCGGAGCTGTTGTGGAGATGCTTGGAGATGACTTCACGTATCTGAAAGAGAATACGATCAGGTC
GGACGCGCTGCTTTGCATAGAATTTTTGAACGATGATGCCAAAGTATAGTCGCGCAAGGGCATGGAACACTTACATTAATGCCACATTCAAGTATGTAAT
TCATACTTTAGCGACTAGTATTAATATTTGCATTAGCTGTAAATGCCCCGTTTTACGAGAGAAAACAGGTTTGGGACACCGACCGCTCTCATTATACTGT
GAGCATGGAACTACGCGAAGGTTGCGACTTAGGTGGGCTCCACAGCGAATCCTTCACGATTGAGAACTTGAATAACAGCACAAATTCTGATATTAAACTT
TCGGGTGCTGCTACAGACCTGGCCAAAAGGTTGGCACCCCTTACTTTCCACCTATCTCGGCCCCTCCTGCGAGTTTTCCCCTCAAACTTGGACCAATTAT
AGCATTTTTCGCGCTGATTCTGCCAATCAAATCTAAGCGTAATCCAGCCAATTTTGAGAGACTTTCTATACAATGATTGCTCTGCGTGATTGGCCAAAAG
GTTGGCACACTATTATTACTTGATTTCAGTATGGCAATTATGAACGAGTTGTGTACATCTCAGGTAGGTGGTCATGCATTTAGAAAATGCATAGAAAATA
CCTTGCATGTGGATTCTCGTTCTTGCAGAGAGCAGTAGAGCTGGCCAACGCAACGGGAGCTGGAGACGGGCACTACAACCGCATTAGAACGCTTAGGGCG
AATAGGGGTCAGCTCTACAAGTGCGGATGAGTCGTTAGTGACTGGAAAACCCAGCGGTATTTCGATCGCCTATACAAATCACACTCCAGATATTGCCGCC
GCTACCAAGGCTTCATGGTGGGCGACAACGAGGCAGCGCGCTGCCAACTGCGTTGTATTTGCATTAGAAAGCGCTACGGACCCGCTTCAGCCGCTGCAAT
GTTTTTAGCGGGGGCAACAAACGCCGCTACTCATTCGTTTAAGGATAAATACCTGATCTGTACACAACATGTACATAATTTACATACTGAAATCAAGTAA
CTAATAGTGTGCCAACCTTTTGCAGCCTCATTTTCGAGTGCTTGTATTAAAAGTTCCTCAATATTGCGCTAATTAGGCTGTAATTTGATTGCTAGATCAA
GCGCACTGAGCACGCTAATTGGTCCAAGTTTGGGCACCGAGCTTAAAATTTTGAGTAAGTTATGGGGAGAAACAGGGTGTGTGCCAACCTTTTGGCCAGG
TCTGTACTGTCTGGGGCAGACAGCTCCCCAACTTTCTCCCCCCTCTAAATCGATAAAGCAGTATTTTCTATGCTCCAATACAATATAAATTACGGAAATA
TGTATTATTTTTTGTCAAATAATTGTTATATTTATTAGGGCTCGACAGTGATCATAATCCAATATTATACGGTGTTGGCGGACCTCGAGGGTACGCAGCA
CTCTGAAACGTCCACCACACCCGCGCTGTCCTTCTTCATATCCTACTCCAACGCGAGCACTTGTCGCCCACCAGGGCAGCATCCTCACCCTGAATGAAGT
TGCTGCACCACACGATACATAATATCCTTTTCGGCTCGTTTACTTCACAGGTGTTCCGTGGCGGTAGAATCGACTTCCCTTCTCCTGGGTGATGCCCCGC
CGCCCAGTAGATGGGAAGTTGATTCTACCGATGCCCCCAAAGCCATGGGAATATTGCTTTCTGTCGAACTGGGTAGGCAGATCGGAGCGTGTAAGTGCAT
ACGAGTAGAGTAGACTACGGAAAGAACGCTTCGCTTCCGCGGAGAATGTTTGGGATTGAGGGGGGAAAAACCTCGAAGGTGACAACCCCCTCTTGGTTAC
ACAAGTAATACACAACTAACGGCTCACTGGACAAACTACAGTTTGTATGGCGGCAGGGTGCAGAGGCGTTCAACGTCAACGACGTTGAGCTGGCGGAGCT
CGACACGCCATCTCCACACTCCTACTTCGAGTACGCCACACTCTGTCGTCCACTAGCACGCACACAAGGCTTGACCGTCAGCTTCGCCACTTGTAATGGC
GATCGGCACCGGCATCAAGTTGAGCGGCTGCCGAAACTTGTTAAACAGCGTAGGACCCTAAGGCTTCGTGAAGATATCGGCCAGCATGTCCTTCGAAGGA
CAGTAGAGCACCTTGAACTCGCTACGCTCGTGGTAGTCCCTGACCTTGTGGTACTTGAGGTCCACGCCCTTGGTCTTGTAGTTGCCTTTGATCTCGGTCA
GCACGACGATAGCAGCCTGGTTGTCTTGGTATAGGATGGTAGGCTGGTGGCGCGGGAGCTCCAAATCCTTGCACAAATTGTGCACCCACACGATCATGAT
GGAGCACTCGCTCGCAGCGACAAACTCCGCGCAACACGTATCATCAGTCACAATTCGCTGTCTGCGTGACTTGTACGCGAACGTGCACCCATTTAGCTGA
AGCACGCAGCCAGTGATCGAGTAGCGACCATCCATCTCAATACCAAGCTCTGCATCTGCGTAGGCCACCAAATGCAGGTCGGGTGTCTCCACCTTCTCCC
ACGCTAGTCCATAGTCAGTGGTCCCTCGCAGATACCGCAGCACGTGCTTCGCCACCACGTAGTTCTCGTGCGTGTACTTGTCCAAGTACTTGGCGAGTGT
AACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCACGACCTTGGTGTAGACAC
ACCAAAGGCTACATACATTTACGACCACCACAACGGGTGGTCCATAGAGACTTAGGATTCCTATCGGCTGAGAGCAGCATCTTTTAGCCAATGAGCGACA
TGCATAGCATTGGAATTCTGCCAATCAGCCGTTGGCAGATTCCTATCTTAGAATATCACATTTAGAGGAAGTCAGAAACATAAAACAAAAATGGCAGTTC
TCATTTTAACCCAAAACATTATTTGGATCGTTTATTTAAATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAAGCTACGCTTCC
TCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGATGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAG
CTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGC
TGACTGTCCCCACCCGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACA
CCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTACTACTTCCGCGGTGTCGTCCGGGACGACACAACGCGCGC
AATCGCTGAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACAGCCATTGCGGCTCGACGTAT
CGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGACGGACGCGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGACCCTACGTGCTTT
AGCACGTACGAAGGTTTCAAGGATGAGCTCAGACGAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCA
AGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAA
GGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCAAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTG
CGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTG
CTGGACCCCATCAGTCGCAGGGAAACAATGTGCGATGCTACGTTGCGGTGGAGTCGGTCACTTTGCTCGGAAGTGCACGGCTCCCGTGCACCAGCAGGGT
GGCTATCGCGGGCACCGTCGCAACCAAACAAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTAGAC
ACGCGACACTGAGGACTGCAGCCCCCAGTGAGATTCAGTCTCGCTGCAAGAACCAAGATGACAAGCCTAACCTTGTCATCCTGAATGTGAACTCGATGAG
AGCAAACGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATA
CCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCACATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTG
TCGAGACCTTTATCGTCCTGGATCTGAACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAGCGC
ACTCTCGTGCGCTTCGGTCGCGACAGCGGAACACAATACCTGTTTCTTGTAAACTTTTTTCATCGCCCTGCTGCCGCTACGCACGCACCGACAGGTGCGC
GCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGACCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCAAGCGTCGGCATCGCCGCC
GACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGACCTCAAGGGGCACGGATGACGCAGAC
GAGTCACACGCCTCAACCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTAACGTAACGCCGTCGACTCCGGGAG
TCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCTGCCGCGAGAGCAGGTCAAAGCGATCGACGACT
TCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCAT
CGTTCATGCGTATAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATGGCCAGGAGCACTATC
TACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTAATGCGTGAGAGCGATATCCCTCTCTTGGCTGTGAGCACGCCGAGCGGCATGCTCTGGG
AGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCAACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTA
CTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGAAAGCCGCTTGCGCTCATGCGCAAG
CACAAGCTCTATGCAAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGCCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTG
AGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGCCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGA
CTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGG
GTCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGCTGATGC
AGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCGTTAC
CATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGGTCACGCGTCGTTGCGGACGGCTGTGAAGTCG
CCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACATCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACG
CGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGT
GGAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCATGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGT
GCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACA