Description :
From Genome Similarity Track
Location :
Scaffold_3:566602- 567785
Transcript NameFunction/comments
Phyca_LT153413290alanine racemase

Sequence
1183 bases(100 bases per row)
cgcaactggataaggacacccagcgtggtgctggacgagaagcgtctgctgcagaacatcgagcggatgcaagcactggcgacggcgaaccatgtaaata
tccgtccgcacgccaagacgcacaagacgcgagagatcgcggcgatgcaattggcagctggagcttgtggccttacagtctccaagccgtccgaagcact
gcaattcttacgcggtgacgtgccaggactcaagagtgtgacgttggcgtatccggtggtgcagagtaataaggtggaggaggtaatcaaggcggcgcag
gcggctggcgtggagttccagttgacggtcgacagcccagaaggagttgacgctgcacagaaggcagcagaagcttgtggctccactttaaagctcctga
tccacattgacgtgggatatcatcgagtggggattgaagaaaacgacccaaagttactgcaactggcgcagcggattgacaaaaccagtagccttgagtt
ccgtggactgctatcgcatgcaggtcacgcataccgctgcaagtcgaaagctgaatgttcggaggtggcggagacggagaggcaaatcgtagtacgcatc
aagtccacgttggagtcgaacggtattccagttccggttgtatccgtgggtagtacgcttacggaggctgctcggaaaagcttcgagggcattacggaga
tccgtccaggcaactacgtgttcttggatcgcactcccgttcgtatgggcctgttttccgtgcaagatgtggcgttgacggttctcgtgacggtcgtgag
ctccaacaattacaatttcattgttgacgctggatccaaggtgctgagttctgatggcgcgcggtcagctggcgactttggctcttcgtgcttcggtctt
gccttttacgagaaggattttgagcgtgtagtgaaggaaccgacgcaaaacaaatccgtactcgacgatggtaaggagctcatctgcttcgaggtgacca
gcctgtcagaggagcatggttgggtgaagaagatcgaaggcatcccttcacctgccattggtgaacgtctcataatcgtgccaaaccactcgtgtgtggt
gtcgaaccttacggacacgttttacgttcagggtgaggagccaaagagctggactctcttgtctcgtggatgcacgcagtgat