Description :
From Genome Similarity Track
Location :
Scaffold_261:5666- 11628
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_261-abinit-gene-0.31Superoxide dismutase
Pytir_DAOMBR486maker-pir_contig_261-fgenesh-gene-0.3Patatin
Pytir_DAOMBR486maker-pir_contig_261-snap-gene-0.19Protein H39E23.3, partially confirmed by transcript evidence
Pytir_DAOMBR486maker-pir_contig_261-fgenesh-gene-0.9ATP-binding Cassette (ABC) Superfamily

Sequence
5962 bases(100 bases per row)
TACAAAAGCAAGATGCTGCAATCTGATAAAGAGCTCTTTACAATGATTGACGATGGCTACACTCGTACGTCTATCTATACAGGCTTTTCTGGACGTGGAT
GACCAGCCCAGGCTCGACCAACACGGCCCCGCACGGCGCGTTGAAGACCCGCATTGAGCAGGACTTCGGCTCGCTCGACCAGCTGAAGGAGCAGTTCAAC
GCCGCGGCGTCGACCCGCTTCGGCTCGGGCTGGGCGTGGCTCGGTGTGAAGGCGGACGGCACGCTTGCCATCACGTCGACCCCGAACCAGGACAACCCTC
TGATGCCTGGTGTGGACCAGCCGCTGATCCCGATTCTCGGCCTCGATGTCTGGGAGCACGCGTACTACCTCAAGTACCAGAACCGTCGCCCAGAGTACAT
CTCGGCGTTCTGGAACGTCGCCAACTGGGACAAGGTCGTCGAGTACTACGACAACTTTGCCTCCAAGCAGAAACCAGTGGAGATCTGAACTGGTGCTGGC
AGCAGCAGCGACCACGTGAAGCAGTCCCATTTGTAAGTACTCCTCTCTGTGTTCTCCTCATTCTACATCTGGACGCTCAAGCAAAGCAAAGCAAGTGATG
CGTGGAGGTATGCGCCGTGTTCGTGTTCGTTATGCGTTGTTTAATTCTTCAGCAATTAAATAAAAACAAAACGGACATGAGTATTCTCTACAAGGCGAAT
TTTGCATGCGCTTGATGTCTTTATTGATGTGATGTTGCAGTATGATTTTGCAGAGTTCACATTGCATCCATTCAAGCTTGAAGTTTAAATACGAGCGGCG
TGACTCGCTGCTCCCCATTGTCGGTCCCATCTGCTTGCACACACACACACACACAGTGTGATTCAATGGACACCAGGACAAGGATGACAGTTGATAGCAG
CTGCACGATGCGTCCGTCACACGTACAGATCGCAACGACGGAATATTGTTCACGCAGACCCACGATCGTGCTGGCTTTTGCAGCCCCCGCCTGGTCTAAA
TGCAACGGCGCGCCGTGCTGATCCACCAGATCCACCCACGCGAGCCCAGCCATCAGCTCTGTTATCATACGCGATACATAGAAGCACAGCGATTACGACA
TGCAGATATACGCTAGAAGAGCTTGTGTGGACAGAGCCCTACCTTTTGCGAACCGGGCAGCCATGTTCACGATCTCCAACTGTTTCTCGAGCAGCTGTTT
CTGAGCGAGCGCCGCCACGATCTCCTCGTTCTGTTCCTCCTGCGCGGCGCCGCTATTCGCACTGTTCCTCGTGGTTCCAGGCGTCGTCGGTCTTGAAGCG
CCGCTTGGAGGTCGTGAAGTCGACGGCGCGCTGCCATTCGAGAGCGACGCCGCTGAGAACGCGGTCGAGTGCGTGGTGGAGAGCGCGCCAGAGTTGTTGC
TGGCTCTCGTGGGCCCTCGGGGTGTCTGCTGCTGCAGTAGCGTCTTGCGCAGCGCGTCGAGCTCGATGGCCAGCTGGATGTTCTTGTGCTTGCAGTAGTC
CTCGATATCGCGGATGCACGTATTCCTGATGAAGCTCAGCAGGATGGCGCACGACACGTTCGAGTTGTACATCTTGACGGGCGTGTTCTCTGAACGGGTA
CGTCAGTTGGGTACAAGATACAGATGAGAACGTAGGAAGTGAGATGCAGATAGTACACACATCGAGAGAGCCTGCGCGAGTGATGATTTACTCATCTCAC
TCGCAAGCGCATGGACAGAGAGAGAGAGAGAGAGATGATGACGCACCGAAGCCGTACTTGACCCAGAAGAACATGGCGCTCGCCTGACGTTGTGTGTAGT
GTCCCCTCTCCTCTCTACTGTAGGACGGTGTGATCTCACAACACAGCTCAAATTGAAGTGACCTTTCACCCACTGAACCCAGCAGGGCAAACTAGCCACC
TTTTCAACCCGATACTTTCTCTTTGGTTTCTGTTTACACAGGGCACTTAGTTAAATAGGTTGCTTGTGATATTTTTTGAGATACCGCACTATAAAGTATA
AAGTAATATCTATTTTCACAGTGCAGATGTTATAAGCCAGTTTTCCACGGAGTTTTCCACGCCGCTTTGCTTTGGAATTCGTTGTCCGCCACAACTGCCG
CTTGATTGACAAGCTCCACTTCAAAATGGCGCTCCTGCCACGCACCCGCGCTGCTGCGCTTCGCTTCGGTGCACCGCGCCGCGCTCTACCAGCAGCATCT
TCACTACTACGCGCCTACGCATCTGTACCCGCTCCAGCACTTGCACAGGCGCCTGACGCACCTCCTCACGCACAAGCTTCAACACCCGCGCCTGCTTCAG
CTCCAGTGCACAACTTCGCGTTCAGCGGCTCCGGATTCCTCATCCCGTACCATTTGGGCGTCGCGCAGGGGCTCGACGAGGCCGGCTTGCTTACGCCAGA
ATCTAAGGTCGCGGGCGCGTCAGGTGGCTCGATCACCGCGCTCGCGGTCGCTGCAAAGGAGGTGAATGTACTGGAGATACACGAAGAAGCCAAGCGCCTG
ACGGCGCTCTGCCGGAATGAAGGCACGCTTTGGAAGGTCGAGGCGCGACTGCGTGCCGTGTTCGACCTCAAGTTCAAGGATGTGGACCTCGCGCCGCTCA
ACGAGCGCCTCACGATCGTGACCCAGCGCGTGTGGCCCGACCGCAAAATCGTGCAGTGGAACCACTTCAACTCGATCGAAGACGTCGGTAACGTGCTCAT
CGCGTCCTGCTACATCCCGTTCTACCTGGCAACCCAGGGTGTGACGAAGATCGGCAACGAGCTGCACGTCGACGGCGGACTCGTGCAGCTCGTCCCCGAG
ATCCCCGGCTATGTGAAGGTGTGCGCGTTCCAGGCGAGTGTGCTGCGGCGTCCGGACTACGAGATCAGTCCATCACTCGTGCCGCGTTTCCCCTACAACA
TCTTCCAGTTGGCGCAGGCGTCGCTGTCCCCGCCGTCGGAGAAATTCCTAGATGAGCTCTTCCAGTTGGGCAAGCAGTCGGCGTTCATCTGGGCCGAGAA
GCAGCACAAGTAAGGCTATGTTTAGATCCCAAGCAGCGGCGCGATGCTCCAATTTTTCACCTTGTTATTTTTTTATTTGATACTCGAGCATTATTCGGTG
GAAATCAGCCACTAAGAACCCACTAGAATCATGGCAAGACGGGCATAAAATAATAGTAAGCTCTTCATTGAAAAAACAGGCAACTAGCGGATGATTTTGC
CGCATCGTGATAGGTGATTCTTTTATCACCTCTAATCTTCACCCCCTTCTTGTTCTTGTTCTTTTTCGTCGTCGCTGCTGGACGACGTCGATCCAGAAGA
TGATGACGAGGATGACGAAGAGGAGGACGAGGATGAGCTGTCGTTGCCATCTTCATCACCGATATCTTTTCCAGTTGCTCGCACACTATCAGCCTCGTCA
CCTCCATTGTCATTCTCTGAATCAGAAACACTCGACTCGAGCCCATCCTCACCCACCTGCTGGTCTCCCTCGTCTCGTACTGGTGGCTTGTTCTCCTCTG
CCTTCGTGACTGACAGCTTTGGTATCTTCGCGCTGCTTCCCGCTGGCTTCGCCTTTGGCTTAGCTGATGCGCGCGCTGTCGGTTTCTGCTCTACTGGTGC
TACGTCTTCATCCTTCGTGCCATTCTCTTTCCCGTTTGAGTCTGCATTAGTGGCTGTTGTGTCGGCAGCTGCAGATGCGGAGATGCTGGCAGTATCGGCA
GTTGGAGCGCTTAGCATGGGCTTCTTGCGTGGACGTGGTGGTCGTTTCCGTGGAGCAGCTGGAGCACGCGACGCTGACTGCTGGTAGCGCTCAGGCGCTT
TGCTAGCCAGGGCTTTCATTCTTGCGCGCCGTCTTGCTGCAGCTTCTGCTCGCGCACTCGTCGAAGGCAGCGGCAGCGCCGCATCGCTCGTCTCCAGCGC
TTTGAACGCGGTGTCCGACAGCTTTTGTATCTTGTGCGGAGGTTCCATCGCCAGCGCAGCGCTCTCTTGAAGACTACAAGGTATAAATAATAAATTGGTT
TGCTGTGGGGCTCACCTTATATATTCATATAGATCCAATACTAGCATGTCGTACCTCTCGAGTTCTCTCGCTTTGATGTCTTGCTGCCGCTGGCGTGCGA
GTTGCTTGGCGTCTTCCAGTTTCTGTGCTTCGAGCTCCAAGTTTCGCGCCTCCAACGCTGCAAACTGGTCGGGATTGAACTGCACAGCACATACCACGCA
ACCATCTCATTAGCCTCAATATCAATACAAATATACCTCAGTCTCAAAGCCCAAGCCTACCATGAGGTTGTTGCAGTAGATGTACTGCACGGGGTCCTTC
CCAAAGACACAGTCGTCCGTCAGTAGCTCCGGCAGCTTCGAGAGATATCGCGGGAACGCGTACGCGGCTTTCTGCGTCGCGCTGCTCTCTTCAATCATGC
AGTTGTCGATGCCCAGCGCCTTCTCCTTCAGCTCTTCGTGGTACAAGAGCGACTCAAAGTCGTCTTCAAACACGTCCGACTCGCCCGAGTAGGCGTCCGA
TAGGTTGTCGAGGAACTCTTCGTCGTCGTCTTCATCGCGTCCGCTGCCCGCTGCACCATAGATCGAGTCAGTCTCCAGGTCGTCGTCATCACCACGATCA
CCGTGTTCTCCGCCTCGATTCGATGATGATGACTGCGCTGCCGGTCGTGCGGGTTTCTTCCGACGCTGCGACGCTGCTGCTTTCGAAGGTGCAGCACTGG
ATGAAGCGATGGCTTTACTGGCGACTGGCTTCCTTCGTGCAGGCTTCCTCATTGGCTTCGCTTTCAGCTGCTCTGGTTCATCTGGCCCTTTCCCTGTTGC
TGCTCCTGCTGCTGCTGCTACTGCTATCGAAGCAGCGGTCGAACGCTTGGGCTTCGAGCTCGGCGCGCGCTTCATGGGCGGTTTCCGCACTGGCGCGCTC
TTCGCCTTCACAGGCTTGGTAGTCGATGCGGGTTTGCTTCTCGCTCTGGATGACTTCGCTTTCGCTTTACCTACGGGCAGCAACGGTGGACTCTTTGGTG
GTGGGGGCGTGGATGGAGGTGGTGGCGGTGGAGGTGAGGACAGAGGAGACTCACGCCCTCTATCATTGCGTCTGGACGTCAAGGGGCGTTCGTCCTCGCT
CGAGCTGCCGCTGGAGCTGCTGCCGCTGCTCCCACTGCTGCTGGAGGAGCTGCTGCTGCTGCTGCCACTCATGCTCAGACTCAGCTCCATCTTGGTGTCT
TCTTGTGCGTCTCCCCTCTTGTCTCTGGGTATGGAAGGGGGCGGCAGTGGGCGGCTTGCCTGGGCTGGCGCTTCTTCCCATGTAAGTTGTGCGACGCGCC
ACGACCGCGCTTTCTGTGGACGGATATTGGCGTGGGCCACCTCAATTTTGGTTCACCTCTTATAGCAGGTGTCCTTATCAATGCATAATGTAGTAAATAT
AACGAGGCAATAAAAATGCAACAGAAGCTAGAAACCAGCTCTGCTTTTCTTCTGTTTTGTATGTTTTAGACAGCTACAGTACATTAAAAAGGTTTATGAA
GGGTGTCCGCACGAACGCGATCATTCACATTGGCGCTTCAACAAACCAAGAGCTCCAAACAAACCACCATCTTCGACCATCGCAAAAACGCTACATGCAT
GCAGTATCCACAAGAGCATATCCTTCGCTCTCTTCGTCTTCTATGCTCTATGCTCTATATTCCCTCTTCTTCACTTCATCCACTCTCCAGCGCAAAGCCT
ATGCCTCTGCGTCGTCGTCGTCAACAACGCCGCCGTGGTGGTTCTGGCGCGACCACATCTCCGCGTACTTGCCATTGCGCTGGCGCAGCAGCTCCGTGTG
CGTGCCCTGCTGGATAACTTGACCCTTGTCGAACACGATAATCTCGTCGGCGTCCTGGATCGTGGACAGCCGGTGAGCGATGATGATCGACGTCTTGTTC
GCGCCGATCTGCTGGAACTCGCGCACGATCTCCGACTCGGTCTCCGAGTCGAGCGCGCTCGT