Description :
From Genome Similarity Track
Location :
Scaffold_14:56643- 63548
Transcript NameFunction/comments
Phymu_g1011hypothetical protein
Phymu_g1012conserved hypothetical protein

Sequence
6905 bases(100 bases per row)
GGGCCAACAACTGCACGTATCTCCTTCCTGTCACCATCTATCCGCCGAATCTTTTTCAGACGAGGTAATTTGTCGGCAGCTCCCTTCGAACCTGCATCCA
GATCTCCCAAAGCATCGATTTCTCCTCTTTTTctctgtacatgtacttcctCCTTACAATCAGGTTCAAACTCGACAACACTTCTTGAATGAGGACGTGT
ATTCCCTGCAGCTGATTCGCTATCTAAGTCCCCACTTCCTGTTCTCACGGAATGAATCTGCTCCTCGACTTCCTCTCTTCTCATTGACCACACCGGCATT
TTCTCCACCTTCCAGATTTGCTCACTGCATCGTGTGTGGATCTGATACTCTTGTACAAGTCGTAGAGCATTCACAGTCGATCCGTCATGTCTGGACGTAT
TGGAACCATTACAATTCCTCTAAATCAACTCCTGGAGCAAGTCGTAGCCCaacacgcagcagtcgctAGTACCTTCTCCGTCAGCATCTGAAACGCGTCT
ACAAACTCCACAACCGTAGCCGACCGCACTACAACGCAATTTGATCGTCCGGAAAGCGCAAGGATGTCGGATGCGTCCTGGAATTCTCGCTGTAATTTAC
CATTCGTCCGCAAAACTTATTAGGGTTTGGCGAAAAGAAACTAGCAGACTAAAAGTAGCGCTAACGTTTTACATCTGAAGTAATTTTAGCTGACTAAAAA
GCATATTTTTTTGCCTTCCCGCCATTTTTCGAACGGTACAAAGGCCCAAGGCGCCAGGCGCGCAAGTACCACCAAGGCGAGTGCATGGAGTCCCCTAGAC
GTGCGTCGGAGGTGGATGCGTCCTCTGACAAGCGCCGACTCTCGGACATATCCTTCTCGCGGCCTGACAGCCCCCTACAAGGCCccaacgacagcttcgt
cgaGTCTCAGCAATGCAGTGCAGACCCTAGTGCCTTCCTAGGGTTTCACGTACCTCCAagcgctgaagaagtggaaaTACCGCAGCAAAAACTgcaaaag
gagaagaaacagaCGTTTAAACTCGTGCTGGACCTGAATATGGCGACAGGCGGCGTTACAAGAGGTAGTGAAGGCTTCCGACCTGTTGCAGCTAACCCAT
TCAGCGAATTATTCGCCGAAGACACGCAAGACAATGCGAATCTGATGGCTCAAGCTCCAGTGAGCAGTAAAGAACTTGTACAGCAAGTGGATACGACGGC
CTCGCTCATTGAGAAGAACAGCAGGCCGCCCACTATGTTGCAGTCCTTGGAGTCAGCATTGTGGGCACGGAAGGAGAAAAttggagaaaaagaagcaaaT
GAAGAGAAAATAACGGAGGACTCTATGCCTGGGACCAGTGCGTATTCGGAGTACAGTGAGGATCTCGCCCCGCGGATTTTTCAGACTGCAGTAGCGGATG
TTGGGACTAtacaggagaaggagaccgAAAGGTTTGATTCGAGTGGTATTGCGGAAAATAGCGACCGTGAGAcggatgacgaggatgaaaTGGAATGCAC
ACAGCCActtgaagatgacgacgatgcagATGTGACTAGAAATGATGACGATGGTagtggcgatgacgaagccGAGACGGAAGTTTTTCCATACTCTGGG
ACTGGAACGTTGCCGTACATGGCAGACTCGATTTATATGGATAAAATTGACGAAGAGATGAGCAAAGATATTGCGGAGGATTCTTTCAGCTCTGAACACG
CGGTGATTGTGTCTACCACGGATCAGAAAAGTAATCAACGGGCTAGTGAAGATGAACTCACGAGTCGAGAAGGATCGCAAGCAACACAGCAGGAGTATCT
GACGCCGAGAGTTAACCCTTGTCGAGTGGAGCAGTTGGATTCAGCGGAACGGAATGCTCAGCCCGTTGTGGTCGGTGTTGCTTCTCGtgccgaagaggaa
gaagattCGAAGGAGGAGCAAAGTGATGATGAGCCAGAAGATTGTGTGCCTACTCAGCCCAGTAAGCCTCGTACAGAAGGTGAACCCGTCGTTGAGCCAA
ACTCGCCTCCCCCGTCAAATATTGCCAGGAAAAGTGTCGTTGTGGTATCTGATTCTCAGACGAAAGCTATTCGCAGCCTTGAGTTTTCTTTCTCGATGCC
AGAGTCACAGGATGGTGAACCTCATTTCAGTGCAAGTCTGACAAGTGAAGGCACACCAGCAGCCAAGCAAATTGAAGCTTTCTCAAGGAACAACAGGCCC
AGTCCTTTCGAGACTTCTATCAGCCCAGTCTACCAGCCTACACCGACACCAGTGGAAGATACAGATGTCCCTGAGGCTACTATTGCCACTACCGCAGCCG
AAGTGAGCTCCAAGCGGAAAACTGTTTCCCCACTGCAATCTGAGATACCCAAAGGtaaaaagaagcagaaaactTCGTCTGAAGCTACCAATTCCCCCAG
TCAGATTGACTCCACTCCCAAACCCAAGAAAAGAAAGCGTGGAGTCTTCTCTCCTGATAGCAGTGGGTCGTTGAAAGAGTCTGACGCTTCCAATCCTCAA
ACACCACGACCTCCTGCGCGACGTAGCACTCGATCAGCCCAGTCAACTCCTTCCTCGACTCCCCAAGTTCGAACACGAGCACGAAATTTAACACCAGTGC
CGCTACAACGAATGTACGCGTCCAGAACTCGTGCCCAGACGCTGTTCAAGTACAAGTTTGAGTTTTGCTTGACAGGTTTCGTGAAAACCGGAGAAGAGAG
TTTGAAGGAGTTTATTGAAGCACACGGCGGTAAAATTCCGGAACGCTATCAGGACGTCTTGTACAAAAACAACCCCAAGGCGGTGGTGATCGCTACTCCT
GTATCGTGGAGGAAGCGCAAATTTATGGAGGCTGTTGCGTGTGGAATTCCTGTCGTCCATACTGACTGGATCAAAGATTGCGTTGACGCGGGGTATGTGC
TACCGTTCGATGGGTACCAAGTACCTACAGGCTATTCCGTCACCACCCAGAAGTTTGAATGCTTTCCCCCTACAGAGGTAAACTTTGACTCTATTTGACG
CTATTTGACGCTCTTAAAAGAATCTGAACTAACCTTTCTTTGTTGTGTTTGCTACAGCTACACATTTTTGAAGGCTATTCCTTTGGCATCGCCGGTGATG
TTTCTCAGACATCAAAATCCGAGGCTAAGGAGAAGGCCAGCTTGGTGGCGTTTATATTAAAAGTTTGTGGGGCAGACGCTGTGTACGAGGTGAGGCCATT
CTTTATGTAGTAGACGTATCATAGTATGTATTGACATTTTGTGTCTTATTTTTTGTAGAATTTGTCCAGCAAAAGCGACGTTAGTGTGGATATCGTGCTA
TGCGACGAGTATACACCAGTAAGTAGAGTTCATACCGATGCTTGCCTTTCCATTGCTAATCTCTTTGACTTTATTAGACATGCCGGTACTACAAGAGAAA
GCGTCACTTACCGGTTAAAAACTTCCAGTGGGTTACTGAGTGCATGATTCTCCAGGTAAGCAACCATCTGCGAAACATGTTGAAAGTTTCTTGCATAGGT
CTAAAAGTGCGAATATCCATTCTTCTGTTCAGAAAATGGTGGATCCCGAGGATCCCGTCTTCAAGCCGCAGCCCGTCGGCAGCGAAGATGTGTTCGCAGC
AACCGCTGAGATCGGCGACAGTGACAAGTATGTCCTCTGATCTGTTTCTTCCGTTGTTGAAGTAGTATCTAACTGGTGGGTATGAATATTGTAGTTCCAT
CCTGAAACTCTACACCGGAGAACTCGTCATGGCAGACATTTCGGGTAGCGCAGCCGATCACTACCTTCTCTTTAATGTCTGCGAGATCCTGAGCATTCAC
GTGAGTGGCCGCAAAGACGAAGGCTCGCAGTCGACGCGAAAGGAAAGTCGCGTTCAGCTTCGGGTTAGCATGCTGAAACGGTGCGTTTTTGTGTTTGTCT
TTGCCCAAAACGTAAATGTAGTACTGACCTAGTTCACTATGATTTTCACCTAACAGCGAGCCTTACAGCCCTGAGCTCTCGAAAACTCCTGTCAAAGTGC
TGGATATATCGGCTTCACAAGTGAAGAGAAGGGTTGTGGCGATCTCGAAGAGCGATTACGCAGTGCTGAAGTATAAGGACGAAAGTATCTTTTGCTTGGA
GGATGACAGCGAACCTGACAACGTTACTGTATCTACTGAGCACAGGTGGCTAACCCAATAAACGCACCACTGGTTTTGTTATTATCAAGAGCTGTTGTCA
ACTCATTCGTGTTGCTTTTCAGCACCGCCTTCCTTTAGATCCCGCTCATCAAGCAACATTCTGTTTGGAATAAACAGATAAAGCCATGGCTAGATAAAAG
CAGTTGATCCTGTAAGTCTGGCGTATCGATCGCTTACAAATTGAGTTGTACCTTTCGCATGGGGTCAATTCCAGTATCCGCGAAAATAGTCTGTTCGTAA
AGGATAGCAACGAGAAAGTGAAGGTATGAACCAAGAGTTCTTCTGTCTACTCATACTTACCTGCCATGATATGATGCCTAGGTGGCTAAGCATCATCCGG
TAATAGTTGGTGAACGACTCTGCAagaaagctccagctgccTCGTAAGTCCTTAAACCAAACTTGAGGTTCTTCTGCTCAAGTAAAAGTTTATTAAGCCA
GGTGCAAAATGACAAGTGCTAGGAGTACGAATACCATTGAGGTAAATGAGAGCGACAGTGCCGTATTTCGGAGATTCCTCCAGAGAGAAGCCTATAATTT
CTTGGTGGCTGAGCTGAAAGTCAATGGAGAGGAAATGAGCTCTTTCAGATTTGACGAACAGGTATCTGGCggctgtacatgtacttttTTCAAATCGAGT
CGGCGCTGGTCAGCAGGGCGACATTGAGAAGGTAAATCCTTTATCGAGAGGCGTTGCAGGCTTTGAAGCGAGTTCACCAAGAAATGTCCTACTAAAGAGG
TGTGATCTGAATAGCCATCAGTGCAAGTTTTTCTTTCAGTTCTTGACAATATTGCGAGTGACTTACCGCGGAACGGCGCGAACCACTTCACTGACAGGCC
GTTCGTCGTCGAGTAGAATCGTTTCAAGTCGTCTGGAAGCACAAACGGAGAGTTTTTCTGAAGTGGAATTAGAGTCGGCTTTGAAAAAGTTGTCAGGTAG
TACAGTAGAAAGAATTCCCGTCCAACCTGTTCCCACAGTCGAAGTTCTACTTGAGTAGCTCCAACAAAGGGCTTCGCTTCGACTCGAGACACTCGTTCGT
GGGCCTGCAAGTAAGAGAACACACCGAGAGAAATGGCGTCGAGGTGCTGCATGGTGAAGTGCCTGAACAGGCGCTAGATCCAAGATAGAAAAACGATAGT
CAGACACAGTCGAGGTTGCAATTCTCTAGCAATGTTACGAAGGAATAGCAGCTACAACGATCTTCACTATGCGCAATTACGATCAGGTCACATGATAGAG
CACTGTTCCTGGCCTGGGGCGCCACCAACTGCATCAATAGCATTGAAAGGCGATTAGAAAGCGAACTAGCGCATTTGTTGCACAAACATGCAGACTTACG
GGGCATTCCAGGCATGCCGGCCATACCGGGGAACATACCAGGGCCCTGTAAGATagagaacaagaagaactacAGTCAGTATGTCAGCATGTAACAGCAC
AGAACGTTAGACGAACCATGTTGGGCATGATCGGCATTCCTTCATCATCAAACTGCAAGCCTGTACATCAAACAAGTAAAGATTAAAACCTCCTTATCAC
CATCAACACGTCAAAGAAGTTACCTGGAGCAAGGTCCTTCACGATCTCGGACGGGGGCTGGCCAGTCTCCTGCATTTCCTGCATGAGCTCTGACAACCGA
GCGTAGTTGTCGGGCTCCGATTCGTACACTGCGACGATCTGCTGGAAGTACTGGTACTGCTTGCCGTATCTATGCCATGTACCCGTAAAACGTTAATGGA
GACAACGGACACGGTTTGTACAATGTCTGCAGCGTTACCTTTCGTAGTCCTCTTTCGACAGTAAAGATTCCTTTTCGGCCAACCACTCAGGATACTACAC
AAAACAGTATGCCTCAAGAGTCAATAACAATTCTGCATCGCCTTCACAGTAAAATACCGTACCCGCTCACAGATCTGCTTCATCGGGTCGTACATGACGt
ccttcgacagcagctgctgcatcataCCGTCCACCAAGTCCTGGAAGTCATTCTGGGATGCATATTCAATCAATAACCCTTACACGACATTGAACACTGT
TGACTCGCTACCTTTTCCCCCATCtcctcgaacttcttcatcatctcaGTCATCATATCTTCGCCCATAGCTTCGACCTGTGCCGTACCCACACCTTCCA
TATCTTCCGCTGCCTTTGCCATattctgcagcgtcttggcgacTCCAGCATTGACGTCGTCCGTCTCTGTTTGGCTGTCGTCCGTCTTGAGGGACCCCAG
TAGCTGCTCAATATTCTCTGCATCCGCTGAATCCATCCATATCACGCAATTAGCAACTCCACAACACCCGACAATACCCACAAGACACCACTGGATACCG
TCTGTGCCCAGCTCCCGAAAAGCTTGCTCCAGGACCTTCTGGAACTCTGGATTCTGTGCGTCCTCGAGGAACTTGGCCATATTCTGCCGTTATAACAGCG
TTAAGCTTTAAAACTGGTATCTTTTCGACCAACAACACCTGTTCTAACCTCTTGCAAATTGTTATCTTCATTGTCCtgcgtcgcagcagcagtggcagct
gCTTCCTGTTGGACGCTCGAGATCTCCGAGGCTTGTGCGGCGTTCACCTCATCGGCGAagtcgtccagcgcgtctACAGCAGCGCACAGAGGCGGTGAGG
GCGTGGGGGAGTGTCTAGATGCAGATTAACGCGTTTACCGTCCAGGAGgtcgtccagatccacctCCTCTTGCGTCTTGGGCTCGCACTCTGCTTTGCTC
ATCGT