Description :
From Genome Similarity Track
Location :
Scaffold_154:5661- 8813
Sequence
3152 bases(100 bases per row)
AGCAAGGCACATATCAGTCGCAATTTTCGTTTTCAGAATGTTAAGGGTACCATGAACAGAAATGACACGTCTAACCGCCACGGCAGTGCCTATCAAAAAC
AGCAGCTTCCATACCACCCCGAGATTGCGATATGGTGTGTAAAGGTCCTTACCGGGTGTCTGAGTGTTTAACATCATCCTACGCACAAAGGGATGAAGCC
AAACGAGCCATGTGAGAGCGCATGGCACAGCTAAGCGCGTCACACTCTCTTCAAACCAGACTTACAGATCACAGAGGTTCTAGCAATAAGGATGAGGAAG
ACAGGCTTCGTGAAGGTGTACCCTGTAGTGCGCAAGTCAGACGTGCTATTTAAGTTCATCGAGTTTCGGCAGTACATGAAGATAAAAGCGGACGTTAGTG
TACGCAATATCCGCAGCGATAATGGAGGTAAGCACACATCTACCGACATGAAAACGTACTGCGCTAAAGAATATCAAACAGGAATTTACGATCCTGCGCA
GCCCTCAGCAGAATGGCATGGCCGAGTGTGCAAAACGGACACTGATCGAGATGGCTCGATGCATGCTCATAGACAGTGGTATAAAAAAGTTGCCTCAGCT
AAGCGCTTCCCACTCTCAGCAAACCAGACTCACAGATCACAGAGGTTCTAGCAAGTAATAAGTAGTTCCCGCTGTGCGCTGACTCGGGTTCGGATGTATT
CGTTTTACCCCGCAGGCTTTTGCTCGGCCTCCCATCTAACACGCACGTGACCACCACCCTCCGTCACCCTGTTAGTGTGAATTTAGTTGGTAGTGCCAGG
TTGGTCTTCCGCGAGCAAATGACATGTGACGTCCAAGTACGTAGTGCTGCAACACCCGTCAACAGCAGGGGTGTTGACTGTCTTTCCCTGGACTAAGACG
ATGACCAGTTTATTTTTGGCAAAGATATTTCTAGCAGTCTTGGAATCGACGTTGGAGCCATGATCGCCAATGTAGCAGAGAGATCAGCCATCGATAATGA
TGGTGATAATCTCACCACCAATGTTGCTGCTGAAGTTGTTGTCGATGTGGATACTCTTAATCTCCTGTCATCACTTAAGTACGCAGCACTGTTGAAAGAG
GGTAAAGATGGCAGCCTTGCGCATGAACTTTATGAAGTCGCCGTCCAATGAAGAGACATTTGGCGAAACCGTCTGGGCTACGACCCACCTGCAACGGTTG
AGCTTCTATAGGTGAAGTTTCAGGTTGATTCCAAGCCTTTAACTTCTAAGAACAGGCCGTATCCAAAGCAACAAAGTGACTATCTCCGTTCCTACTTCGC
CGGGCCAGAGCGTCTGGGTATCGTTAACCAAAATAATCATAGTCGCTGGTCATCACCTGAATATTGGTTCGCAAGGGTCCCAACACGAATATATTTCGCA
CTACGGTGGATTCCACTAGAGTGAACCGCCTTGTGACCCCCCTGGATGGAGCCATGCCAGATAGGAAGACAGCTACCGCTCGTGTCTCCATGCTAAGTGT
TATGTTCTCTTTGACAATTCTAAGGCTTTTGGCAGCTCGCACTTCATCTGGACTACCAGGAATAGTTCTCAATGTTTACTGAGGATGGCGTGTACACCTA
AACCCGTGTGCCGCAGGGAGCTACCGACTCCGCAAATGATTACCAGACCCAGATGCAAAAGGTGTATTCCCCATTGTTGCATGACAAATTTCCGGTATGA
ATTGATGATGTTATCATCTTTGCTCAAACGGACAAGGATAATTTGTCGACAGTATTTGCCACTTCTTAGAATTGACTTCGCAGTACGGCCTGAAGCTTAC
GCCACTTCACGGCGTGAAGTCCTCGCCCAGCGCCACGCCGCCACGCCCACGCACTTCAAGATGGCACCATAAGGACGTAAGCGCGGTGTTGATTGGGCCG
AGTTTGATTACGTCGAGAACAATGTCCAGCACACGGTCCCACGTGTTGCGTGCAACCACTGCGCTTCGAATGTGTCCGCCTCAACTGCGAACATGAGAAC
GCACTCAAGCAACTGCTAGAACGGCCACGCTCGATGGGCTACTTGCCGATCGTTATATCGTTATCCTGTCCAGCGGAAAAGTCCAGTCAGTGCACCACTA
ACTTGCAACAGCCCGCCAAAAAATCGATCGCTGACCTTCTAGGCGCGAAAGTGTACCCTCCGTGGTCGCGCAAAGAGAAGGCCGGCCTGGAAACCCTCTT
CGCGACCGCGATACACGAGACTGCGAAGACGGTCAACGATTTTGACCACCCTTTGTGGCAGGCATTCTTCACCCACGCCGTTCCTGGTCGGAGTACGCCA
TCCCAAGTTTTGCCGTTGGCACCCCTCCTCATTAAACCATATGAGAAGTGCATAAAGCTGGCGTTTCAAGACCTGCGCACGGCGGAGGACGTGATCATTG
GCATGGAAGGCGCGACTAATGTCCTTCCGTCGTCCATGTCGAACATAATTGCGCACATGACCCGGCCTTGGTTCGCTGAGTACCAGCGGGCGGATCTCAA
GAAGGAGTCGGCCGATAAATTGCTGGTAAAAATTAAGACATCTATCGATGCGTTGCACCACTCGGTTGGTCAGCAGTTCGTGAACGGGTTCATATTGGAC
TCTTGCAACGTGATGCGCTGTCTGCGGGCCAAACTCGTTGGGTAGAAAGTGGTCGACTTCTCGTACGGATGCGCCGCCCACCCAATTAACAACCTGGTTA
AGGTCTTGCTAAAAGTGGAACCGCTTATAAAATTCCTCAAATAGGCCATGTTCCTATCTAAGGCGGTGAAATACCAGGGCCTTTTGAGCAGAGTCTTCTC
CTTCATCTGCAAGCGGTTTTTTGGTGTGGCGCTGGTCATGGTTCTGTTCTCGCTGTCTCGTTGGAGCAGCGTGAACTACATGTTCCAGCGCCTTCGAACT
GCACGCGGCCCAGATGTCATTGGCGGTCCGAACCGAGAAAGAACAGCTCGGTATCGACCCATCGTTCTCGCTGCCCTCTGCCGTCGTTGAGAGAATGCGA
GACGATCTGTTCTGGAGAAGGCGTTGCCCTCTCCGCCGACCTCTTCAACCCGCTTTGCAAGTGCATTGGCGTGGTGGAGTTTAACCCTCGGCAACAATGT
AGACAGCATACGCATGCTTCCTTTACATGCTTGACCACATTAATGGTGTTAT