Description :
From Genome Similarity Track
Location :
Scaffold_646:5661- 6716
Transcript NameFunction/comments
Phyci_88539Hypothetical protein

Sequence
1055 bases(100 bases per row)
TTTGCTTGCAGCCATCCGGTTCCGCTTTGCGGTGTGAATTAGCCCAAGTTCACTAAATAGGCATTCCCAAGTAGCAGTGTTAGCTGCAATTGAAATCACT
CTCATCACGAGCTTTGGAAGTGCGCTCTTGGGGTGCTCTAATGCAACGCATTCCCAGTATTGCCACGGACATATTGGAAAGTTACTAGATTTGATGCGTG
TAAATCTACCCTTCATCCAGTTCAACATGTCGCGTCGTATCTCTCCTATGTATTCGGTACCAAATAGTCGACGATAGTAGGACACGGCTATCTTGCACAA
CGAGCCGATACCAGATACTGCTGTAACGGGTAGCTTCCTGGTGGTGTCAGCGTACGTCGGATGCAATGCAAAACCAAGCATATACAAAGGCTGCTCGCAC
TGCGCCCAGCAATTTTCAATCAGCTAACTAGCTTGTCGTGGCGAACAAGATGCTGATGAAATCCGCAGTAGATGTCGCGAAACGAAATAACTACGTCGGC
CACCGTCTTCTCATCTCGCTGCAGTCGGTAATAAGCGAAAAACAGAGGAGCAATGACTGCTTCAGCCTCTTTTAGTTCTTCCCAGAATGATGAATCGCCG
AGCACATGAAGGTTTGACGGAAACTCACTATCATTTTTGTACTTGCGATAAAACACTTGTAAAGCTGATTGAACTCGCAGTAATGACGCAAAACAGCCCT
GCATCGAATTCCATCTTGTTTTGCAAAGAGTCCGCATCCCAAATGTTTTCCGTAAAACGTTATCATCATTTCCCGAGCACGAGGTAGCCACTTCGAAGAC
GATGCATTAATTGGCTTTACTGCTGTCGCAGCGCTTGCGGCCACGTCTCGAAAAGAAGACCGCAGTACGAACATCACGAGATTATTGATGTCATGCGCAA
AACAGAACAAGAAAACCGTCCGAGGCCATCGAAGAGTGAGCATTCTGCGTGCACGTCCACATTGACCAGCATTATCAGTGACAATTGCGCCGACCCGCCA
CTGATCTAGCAGTACTTGCCCTAGTAGTTGCTCGAGTTGCTCCGCAATAGCTACA