Description :
From Genome Similarity Track
Location :
Scaffold_1885:566- 3507
Sequence
2941 bases(100 bases per row)
CTCGCATACGACGCGGAGGCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTAGTACGGGCCAGATCCACTTATGCGAAAGGCCTCAC
CGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTG
ATCAGACAGGTGCGAGGTGAGATTGACTGCAATGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGATTGGATGAATCACGAGT
TAGTGCATGTCAAGCGATATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTTAGGTGGAGAGAGAGGCCGAGCA
TCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGG
ATTGGATCCAACCCCCAAATTCTCAAGGAAACATTTGTGAAGAGATTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGAC
TAAAGAAGTATCTGATTGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTT
GCTCATCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCAC
TATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGCTCCCACTGGAGAGGACTATTTAAGAGCGTACAAC
GATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATACCCAAGCGACTTACCCTTTCCAAAT
CATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTTACCGGATACGTGGTAGCCAAAGCTAGTGTC
TACATATTCAGCTGAAGTTTCGCCATTTCATGAAATTCCGCTTTTTCTACCATTGTTACGAAAATCATCAAAAAGACAAACAATAACGGCAAATACGTCT
AGAACGGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGT
CTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACA
GACGATCACAAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAA
GACAGGATCCGGGGTGATACCCGATTTTACTTGGTACATGGGTGGGATTCCAAATCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAA
ACCGAGATCCTATGTGATGGCGATACCAAGTTCAGAAATACTAGCGGCAAGCTAGATTCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGT
GGGATCTACACAACGAAGACGCCCGTTCACATCAAATCCGAGTGGGATCGCAGGTGTGGCTTTATTTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAAT
TGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGGTGTGAAAACGGCATGTACCGAATATCGCCTGTTCCCT
GTAGTACACGTATCCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCCATCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGA
AGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAACGAACTATATAC
GAACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACGCTATGATT
TCTTGAGAGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAAGGGACCCATGGATGTGAGTTGGTCATGTCGATGG
GAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGAATCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACAAAGACACAG
GGGAAGGGTGGATTAGGAGGAAGGAGTAAATGTTTATGCATAAGGGTGACGTTTTACGTGCGAGGAGCCCTGTTTGATCTCAGCACGACTTCAAGGCCCC
ACTATATGACCATGAAATGGTCATGGGCTAATCCGATGAATCCAGGGGGGTCCAACGAGATCGAGTTTCCCTCCACGATATAGGCAGTGTTAACTCGTGA
AGAGAGGTGGTATTCCCCCCCAGATTCGCAGTGTTAACACGGAAAGGTGAATCCGCCCCACTCCCGCCGAATGTCCCAGGTGAACTAGATTTCGCAACCA
ACGAGGGAATGTAATAGACATATTCAAGTAAGAGAGTGTGGATTATAATAGCTTATGCAAAGGGCTAACTCGACCCACTTTCCAGTCGCTAGTTACTGCT
ACGAAACGAATCCACGAAGCCTGAAACTAGGGGCGTGGCGTCAAAGCGTGATGAGGATCAGGTAGTCTTGGGCTGAACGTTGAAGAACTTGCCCACTAGA
CGCTGGATCTGGCGTCCTGGGTGTTGGGCTCAGGTCCCCGC