Description :
From Genome Similarity Track
Location :
Scaffold_3297:566- 2584
Sequence
2018 bases(100 bases per row)
CAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAGCTACAAAGGCAAGTAAACACACCCGCAAGGCAACCCTACGGCCAGATCCAC
GATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTGAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCAACCCC
CACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAG
TTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCC
GCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGA
GGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAATCAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTG
GATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGAA
AAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACCCAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAA
AACGAGTAAGACTACGCGGAAGAAGATGTAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCAGACAAGGATCTCGAGTTTGTG
TATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGTCAGATCGAAGATCCAAGGGAACCGGTGAGAGCAC
CAACGAAAACGGCGAGCAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCACACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTT
CGAGCTAGACTTGGATCTCATAGTATCCGCGACGCGGGACCTCTTCGTCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCACACTATGGATCCAGTGTCG
TCGCCGATGATCAACCAAGCTGCGTCCTCACACTACGAATCCGCGGCTGAGGATGAGTCAGACACGTCGTCCGGACCACGACGCATGACTTTAGGACCCT
CCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAAGCCCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATTTG
ACACAAACCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGGGGAGTTATTGTCAGATCGGGCTCAAGGTAATAGCCGTACAGATCCTGACTCGCCAG
TGGACCAGACGGCCACAGGCCCTTCCGCCACTTCCTCAAGACACCCTGCAGCGACACTTTCGAAGGCTGCGATGAGTTCGGTTTCTGGCCAAAACAGGAT
ATTGAGAGCGTTCCGTGCCACAAGCGCAAGTACTCCACGGAACATGGTGGGAGAAGGAGTTCAGTTGGAGGGAAGACAACTCCCATGATGAGTTCGACCC
AGATGATCTGAATGGACCATCCACTTCGTCAGCAGTGGTAGCAACAGCCGCAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCC
ATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAGGTCAAGTCGGCCCTCATGAGAGATCAAGCGT
CGGATGCCGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCAAAACCAGCCAGAAATTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGA
TTTGCTGCGCAGTTCCAG