Description :
From Genome Similarity Track
Location :
Scaffold_156:56599- 61816
Transcript NameFunction/comments
Hyaar_Emoy2811406putative polyprotein

Sequence
5217 bases(100 bases per row)
CCTAAGTCTTCCTCTGACTTAAGGAGCTGTGCAGCTCTGCTACACTTGGTAGCACTTGTAGTCAATCTACGCTTGAGTCTTTAAAGACTGATCCTCTGTG
AGGATGGAAAACCCCACTCCTCTCTCTGAGGCCGAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATCGC
AAGGCCCGGAGGTGCTTACTGCACGTGTTGAGAGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAGATGGCGTCGGCTATGCCTAC
TCGCTATGTGTCTGTTCCAGACAAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTTGAAAACTACTCAGGAAAGGAGGGTGAAAACCTCATCCTCTGG
ATCCGTGAGATTGAGATGGCCATGAGATCAGGTCTGATCAAGCTTGACCATTCACAGGTCTCTCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAAT
GGGCCTTGACGTGTAGCAAGTCGGTAGACTTAGCGTCTCCCACATGGGAGTCGCTTAAGTCACAATTGGTATAGGTGTTTTCACCACCTAACCAGGCTTA
CCGCTTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGGACCATGTCCAAGAGTTGAGAACTCTCATGGCTGCTATGCAGTCTGAC
CCTCTGCCTGAAGCAGTCCATGTGACTATATTTATGAAGGGTCTCCGTATTGGCGTTGCCAGAACCGAAGTCTTTCGGGTTCACCCTTCTACATTCGAAG
AGGCTTTGAGAATTGCTGTTAATGCTGAGCATAACTTCAAGTCGGCCAGACTTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCAAACTACACGAG
TACTCCGGCCGTTAATAGGCCAGAACCGATGGATCTCAGCTATGCTGAAAATGAAGGTGAAGTTGAACTTCAACCTGCTGAGCAGCAACGTGTTGTACGA
CGGTGTTGTACGTGCGGAAGCACTAAACACTTACGGCGTGGTTTCCCTTTGCTTAGACAGCGCCAGGCTACGAGTCAACACTCTACCCTGAGCCAGAAGT
CTGGCATGGCACGGGGAAATGCCGACACCCAGTAGGAGCGGGACGCCCTACTGGGGAAGAACTAGGTTTCGTAACACCTTTAGGAGGTAAAGTTGAACAG
GGCTTAGCCCCAAAGCGTTCCATACCTACTGGTATCGAGCGTGGATACAAGTCTGGCGTGTTGGTCGCTGAGGCGAAAGTTAAAGACTTCGAAAAGCCTT
GGTCGATTTTAATCGACTCTGGGGCGTTTTGCAATTATGCTCGACGTCGTTCCCTTGAGGGAAGTCAGTTTTATGCTGAAGCGCTTACAGCTCATGAGGA
TGATTTCATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCTCTGAACTTAGGTATAAAGTTTCTGGACTTTGATAGAATTGAA
AGCTGTCTTGTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCAAAGCCATGGATTGATTGGAGGTCGAAGACCTT
AGGCGTTACGCGCAATGTTCCTAGCGAAGCTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCACTAATTTGTCGCGAGATTTTGACAGAAG
ATGTCAATGTGCTGGAAATTTGAATGTCTCAGTTAACTAACTCCAATGTTGAAAACACGAATTCTGAGCGTAGCTCGTTGAATATTAGTGATACGGCACG
TACTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGCCCGAGTTATCAAGGATATGATTCCTTTGATGTG
TGTGGGGTGACACGTGAAAATTCACCGAGCGCGGGCGGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATTGTTGGCGAAACGCCATTAAGTTCAG
GGCTAGTCCCGTATAATGTAAGTGTAGTTGCGCTTTTATATCCACTGGGTGAAGTGTTCGAGTTACGTATCTCTTCACCGGATGTCGATCAAGACATCAG
CTCTCGTATCGAGCGTACTACTACTAGTAGTAACCACGGGGACACTATTGTCCCGACCCCAGAGGGGTGCAAGGTCTCATCGAAGAGACGACCTGGACGC
CAGGTGGCAACTGTTAAGCGCCAGGCGTCCGAGCAGTCACATAGTGACAATAGTGATACACTATATACACTTGTTAACGGAGTGACTGGCCAGGTTGAGG
GCAATGTTAGCTTGGAAACCCTTCCATCTTTGGATGCTCTTTGTGAGCTAAACGAAATGTCTGATGGTGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTT
ATCCGCATGAGTGGTCATTATACCCGATGTCGAGTTGGACTCGTCCTCATTAATGGTAGAGTCGGTCCTAGAGGACACTTAGTGCCCGGAGTGGATCGTC
GATCCTTAAAGATCCTTCGGATCCATTCTATCTTTTGGTAAAGGAATTTCAAGATGTGTTGTGTCACAATCCACCATCTGTCTTACCTCCCGATATACTC
CCGATATAGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGAC
GATTTCTTTCGTGATAAGCACGCGGCTGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACAATTTGTGTCAAAAAGCCTAATGGTAAGTGGC
GTATTGTGCACGTTTATAATAAGCTTAATGCTGCCACTATCCCGGTTCAGACACCAATCCCCAGGAAGGATGTTCTTCAGAACAATATGGTGGGATGTAA
ATTGTACAGTGCGCTCGACTAAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCTGCTAACAGCGATTAGTGCCCCGAGCGATATGCTC
TGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCTTTGGCTACTTTTGATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGTTATGCACAAA
CGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTCCATGCG
CACGAATAAATTGTATACAAATGCATCTAAGTACATCTTTGGTGCAGAAGAGATTCCCTTGCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGAC
CCCGCCAAGATAAGGGCCATAGTCAATGGCCGGTTCCAAAGAACCAGAAAAAAGATTTGCGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAG
TGCGAATTTCGCAGATATGGCACGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTCGGGGTAACACCAAACACGAGGCTTTTCAAGCAGTT
AAGGAAAGTCTCCTTTATGCGCCAATACTGGCTTTGCTCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTTCCATAGGCAGTGCTC
TGTTACAAACAGATGTCGATGGGCGCGAACACGTCATTGTATTCGAATCTCGACAGGTAAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGCT
ACTTGCTGTGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTAGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGGCA
CAGTCGCCGCATCTCCCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCCGAATATAGCTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTTGG
CTGATTATCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGAATTAATCCGTGCGGCTTATGCCAAGGATGA
ACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTTTAAAGACTCGGACATGGAATTGTCGGCACGTTTATGTGCGAGGCTACATCGATAATGG
CCTGTTGTGCTATCGCACGGATATTGAGGATAACCCTCCTATCGCTGTCCCTCATGATGAGGAGTTGAAGTACCGAATCCTCTATGAGGCACATGATACC
GCTTTAAGTGGTCATCTCGGTCGGGAGAAGACCTATAGCTCAGTGATCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTA
CGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGCGGCAGCGCCGCTGGCTAGTCTGTCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGA
CTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACTGGCATTGTGGTCTTTGTTGAACGATTGAGCAAGATGGCTCATCCAGCGGCAGTGCCGGCC
TCTATTGATGCCGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTAGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCGGCTTCA
CCGGCAAGTTTTGGAAGTCCATCTTCAAGGTGTTCGGCACCCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAA
TAGCGTCATTAAGGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGAAGCTCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTT
CATGCCTCTACAGGCTACACCCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTAAACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAG
AGGTTACCGATCGGCTTGCTGATATCAGCCCTGCTACTATTCAATAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTTACGACATGTGCGTGACG
CAATGGCTGAAATCCAAGACCATCAAAAACAACAATCAGATACTAAAAACAGAGGTTGAATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGC
TAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTCAAGACAAAGTTGTGTCCGCGCTTCATTGGACCATTTACGGTCGTTGCTAAGAAGGGACTTGCG
TATACGCTCAACCTTCC