Description :
From Genome Similarity Track
Location :
scaffold_24:56596- 59427
Transcript NameFunction/comments
Pl_111953conserved hypothetical protein

Sequence
2831 bases(100 bases per row)
TGACGCTTTGCAGGACCCGGAGCATCCGTACATTACAGACAAATTGGCCATGTTCCCGAGTGTTTTTCCTACAAACGCTAATTTTCCAGAAGAGAAGTTT
CGCTTTCATGCGCTGCGCAATGCAGCGTTTGTGAGTCCGTTGCCACGTGGATTTAATCAGCAGTGGCATCTGCAGTATTCGGTGTTTACGGACAAAAAAT
TGGCCATTTTTGATGATCTTACAAGAGCCACACGTGCGATTATGAGGTTACGTGAAGATGCTGAGGAATCAAAAAGTGGAGTGATGGAGACCTCGACACC
TGCTGAAGATGGTGCTGCGGTTGTGGAGCGTGCGTTTACGAACTACTTGATTCGCCATGTACGGCGGCTAGATGACCGCACAAGTCATGCTTGGATGAGT
GAACTAGCGAGTGGTACTCGCAGTGTTGCGGAATTGACACAGGCGCATGGTGTACCCTTCAAGCAATGGCGCGCAGTGCCAGGGCTTTCAAAATGTCCAC
TTCTGGATTTTGTGGTGAGGTATCGGCCTGGATACGCTGACGCCACTTGGTTTGTGCGGATCAATGTAGTGTATACAGAAATGCGGGAACTTCAGCGAGA
CAGCGCCGTTCGGACAGGTGACTGGTTCTTTAGTCCTCGACGCAACCTGCGGCGAAATCAAGGATGGACAGATAAACTTGTGGATTATTTACATTCGTTG
GCGCGTCAAGCGGCACTAGACACTAGCACAGGGACAGAAAACAGGTCAGCAGAGACACTAGCAAACAGATCCACGACGAATGGCATTCAGGTAGCAAGCA
ACAACAGTGGGGCGACATTACATACGCCAACTACCAGTAAGGAGTCTGTACGACGTACACAAATGACTCCAAGGCTACGGCACGGAGAAGTACCAACTTC
AGCAAATACTTCTGCTTCCGGCAACCAGGCTGCTCCTGGTAGTGGTGTTGTGGATATTTCTTCCCTGTCAACTCTATCGTGGCATGAAAAATGGTCATAC
GTACTGAAGCTGTCGGAATATCAGTTCAAGATGGGGCTGCTAGATCGCGCACATTACTTTGACGGGCTTCTGTCGCTGCTGCAAAAATCCTTAACACCTC
GATCACAGCGCGGGGCAAACGGTCCTACGCAATGTTCGGCCATGCTGGGAATTGGAGTGAATAGCATCATGGAGCTGATCTCTGTGGCGCAGAAATTGCT
GCCAGAGATACTACTTTCAGCAGATGCTGTTCTATTGCTTGTAAAAACAGTGTTGCAGCACTTGCGCTACTTGCTACCTCCGGGTCGGCCAGTACCCCCG
GAGACTACAGGAAGCACACTTCAGGAGGAGCTTTTAGTGGCATTGTGCCAGTTGTTGCGCGATGTGTTGCTCAATGGCAACGACGTCCTCGTTCGTCTGG
AAGATAATGGTACGTTGATGTTTCACCTTTATTAATTGATCCATTCTAATCTTTCTGTTGTTGTGCCCAGCACCTCCATTATGGCCAGCCTTTGTATTCA
CCAATCGGTTCTTCAACCGCGACGCTTATGGCGATACAGCAATACAAACATGCATTGATCGTTGTCGGCGGAAAAACAAAGAGGTTGCCGGGCGCATTCT
TCGCCTTCAACAGGCGTGTCCGTCTTTGAGCTCCGTGGGTGGAGGTCAGGTACTGGCGGCTACCATGCGCAATGAGGCGCAGATCCTTCAGACACTAGAC
CGTTTTCATCGCGTAGACTCAACATCGGACTTGCATCGTGTGTATAGCGAAGTGTTTAGCCCGCTTCCAATTGTGAATCCAAGTGGTAGCGGATCCCCAG
CTGAACTACCCGTCGATGTCGCTGCACTTTTCCTCGTGTGCGAGTGGGCTGTGACAAACCAGCGACCCGCTGAGTACCGATATTTATCAGCACTTGCGTT
GATTGAGATGCACAGTAACACACTTCTGGAATACGGCAAAAGGTGCGTGCGTTTTGTATTCACCTGAGGCGATCAGTGTTGGATATATTCACTAACATTT
GTATGTGGTACGGTTGATTAACAGTAAGGGATTATTACCTCACTGCAGACCTAAGGATCACCAGGTGGTGCTTCAAAGCGCGTTGCAAAATTTCTTACAG
CGTTACGAACCTAAGGTTATCACGGAGGTCACGCAAGTTATCGAGCTTTTTTGTCTCCTCGTCCGGCGTCGATTATTCAGCGTAGCCAGCTTTGTGGAGT
TCGCATCATGTTGCAACGAAGCAGCCTCTACCATGAGCAACAGTCCATTGCTTACTTTAGCCGCTGAAGCTGGGGGTAATGCTGGCATTACTAAGAGGAA
AGAATCCGCGCTGGTTGTTCACACTGCTTACAACATCGAGTGCTCGCCTGGGCGAGGGTATAAATCTGCTGATATCCACCAGCTTTCTTCAAGCGATCGA
CTGAAGCTGTATTTGTGGCAGCTCCCACGAAGTCCATTCCCGCTACCAACATGCGTGTCAATGCTCCCAGACGACAGTTATGATGGCGAACTGAATTATT
TGCGCTGGCTCGAAGTCATGGAACTCCGACGTGAACACCTCAATTATTCGAAGACTCTTGAGCGTGCTCAATCACTCTGCATCTACGTGTTTCACACGCA
CGGCCAGGCTAATGATACTCCGATGGTTGGGACGCCAGGTGCCGCTGGTGCGACTCCTGCTGCTGGAAGCTCCAGCTCTGGTGACACCAACCATGTGCTG
AAGGAGGTGGAATACCAGGGCAAAGTGGGCGAGTTGGTTTCAGCTGTGAAGACGATGTGCGGTCACGATAAAGGGCGGTTCACGCGCTGGTTTTTGCACA
ATATTTACGAAGAAGCCACATTTTTCCGGTT