Description :
From Genome Similarity Track
Location :
Scaffold_166:5659- 7129
Transcript NameFunction/comments
Phymu_g5890hypothetical protein PHYSODRAFT_469895

Sequence
1470 bases(100 bases per row)
TTTGAACGTGTAACTTCAACTTTAGCGCCGCCATGACAAGACGTAACGTTGGCTCTTTCTCGCCTGCAAGATGATAGTACAGTGACGCTCGCTCTGACGA
GGCAAAAGCCATGCCATAGCCGTgctcgtacatgtatccgaCGTTGTACAGTGCCTGAGCGCAAGTTCCAGCGCTCACCAGGTCTGCGTGTTGATAATGT
CGCAGTGCAAGGACGTAGTTTCCCTCGTAGAAGGCGCTGTCACCCATACGTAACAGAGCATCAATACTATCGTGACCAACAGCTCGAGTAATTAACCGCA
AGTACAACTGACTCAGTAGTTTAGAGTCTCGGCTTGACGAAGCGCCAAACAATTGTCGTTCGATACGTTCAATCAACCAGATCGCGTTGCTTTGCGCCAC
TTCGTACCCCATTTCAGCCGCAAGCAAGTAGATCTCTAGAGCCACCGCCCAGTTGCCACGTTGGGCGTGTGTCAGCGCTTGTGTTATCACTTTTGTGCCC
TCGCGAGAGAATTCCGCTACCCGTTTGTAGAGTTCCACGACTTCTTCgcacgaactgctgctggtactcgAATGAATTTGCCTCTGTTTGATCCGAGCAA
GCTGGAAAAGGGACTTGAGATGGCCGACGTGAGCTGCGGCAACGAAATATTCCTTCGCCCGTGCTGTGTGGTAGGTCCCCAGTTCGAGGAAAGCCATACC
AGTATTGTACACTCCTTCAGCGTGACCAGCATTAGCCGCTATCATGAAGAGTTTACGCGCTCTTTCCAGATCTACCGGGACGTCTCCAAGTCCACGGGAA
TAAATTACCCCAAGACCattggcagcttcaccacttcgTGACGAATTGAGTGCTGATTCATACAATTCCATGGCTTTTGTGACGTTAGGAAGACAACCAG
CAAGGCCGTACGCGTACACGTGACCCAATAAAGCCTGAGCTTGGATACTACCCAAGTCaatcgccttctccaggaaTTGTAGGGCTTGTCGTTCTCGTGC
TGCATGTTCTTCAACATCAGACAGATCTGAAGTCTTGTAGAGATCACTAAACAGCGTAATACTCGCGGACTGGACCATAATATCAGCATTGCGGAAATCT
GCGGCGCGTTGGCGAAGGTACTCAGCTCGTTGGGAGTCTTCTGCTGGGTTGACATCAAATTGATATCGAGTACCTTCAGTCTTCGCGAGTCGAATGGGCT
CGGGGAACGCGTACAGCTGAAGGTTTTGGTCGCTTTGAGCGGTAACAACTCGGTCTGCAGCGAACTTGTAGTGCCGCATTGCAGTCGAACACGACTTTGG
CGTGCCGTAGCCATGCAACGAGCGATATCCAAGCGCCATTGAAGCTCCGACGGAACTCCCGTGAGCTGCAAACTCAAAGTACAagtgtgcagcagcatcg
tcatcagctgcagttcgtTGAACGCCGAGGAGGAACTGAGCTTGGGCACTGCCTAAACCAGCGCTAGCGT