Description :
From Genome Similarity Track
Location :
Scaffold_107:56560- 58751
Transcript NameFunction/comments
Albla_Nc14070820putative polyprotein
Albla_Nc14070830

Sequence
2191 bases(100 bases per row)
CTTCGACTTAAATACCACGGGAGCGTTCCCAATCATCACCATGACTCCAGGAGCAGAACGTAGGTCATCAATGTTGCTTCCCCAGTCAGCATCCGTAAAC
GCATCAAGAACTGGCCGTACCAGCACCTCCTTGGTACACAATGCCATGTTCACGAGTCGACTTAAGGTAACGCAAAACGCGAACGGCTGCTTTCCAGTGT
TGCATTCCAGGGTTTCCGAGGAAACGTGATAACTTTTTCACAACATATGCGATGTCCGGTCGGGTACAGATCGTGATGTACATCAGGCACCCGATCAAGG
AACGGTATGGTCTTGACTTCATTTCAGCACATTCCTCCTCCGTAGTTGGTGACAGCAACTTTGATAGCTTGATGTTGGTAGCGCATGGGCTCTCAACAAT
CTTTGCGTTCTGATGTACCGAGTCTGCTTGATCATGAGCGTTCCGGCGTTCTTGTCGTGATCAATTTCCATTCCCAAAAAAATAAATTTCCCCACGCCCG
ACTCCTTCATCTTGGAGGCGTTTTTGAGTGTCTCCTTGACTTCACGAATCTCATCACTCGTCTTCGCAGCAATAATCATGTCATCCACATATAGACATAC
GTGTACGAAACCGTTTCGGGTACTCTTCACATGGACACATTGATCCGCACCAAAGCTCTTGAAACTGCTCTTCAAGAATACATTGCGAATGGTCTTGTTC
CACGCGCTTGCTGCCTGCTTCGAGCCGTAGTTCGCCTTCTCCAGTTTGCACACCATACAATTAGTGTTCTTCACACCGAATGGAGCATTCGTATAGACTA
GTTCCACCAGTTTACTGTATAGGAAAGCTGTATCCGCGTCCAATTGCTCCATCACGTAGTCGTATGCTGCACACGCAGCTAATACAACTCGAATCGTGTT
CATGTTTGCTACCGGTGAGTAAGTTTCAGAACAATCTACTCCAAACTTTTGCTTGAAACCTTGAGCAACAAGCCGAGCTTTATATCGGATCACTGGACCG
TTCTCGTCACGCTTCTTCGTGAACTGTTGAAAAGACGCGACTAGTGATGTTGTATCGATTATAGATGGGAGGTAACAAGGACCATAAAAAATACATCTAG
TTTCTTTTTACCAAACACTGATCAGGCGCCATGAAAAAAACAACAGGTTATTAGCCCAAGCCCCCCGGAAGATCCTCCTGCGGCTTCACAAGGCGAACTC
GATAATGCGACAAGTGTTAGCGCGGAGATCTCTTAGCCAAGTGAGCACGGGGCCTCGGAATGTGGTACAGATCGTATGGAAAGAATGGAGTGGCTCATTG
TAAATTTGATGCGCGATATGGTGCGGTATTGCGTAGAGCATACCCAGCTGCCTCCTGTGGAACCGGAATTCCGGATGGGGAGTGCTTCGAGCGTCTTCAC
CCAGTTCTTGGATGCTAGGCGACATCGAGACAGAACTGACTCGCTTAGTGAGCCCATGGGGGTGTATATGCCGTTTGTTCACTCGCAACCCCAAGCGCAG
CACCAACAACAGCTTTTCCCTATAGTGCAGGCTACGGCGCAAGTACATATGCAACCGAGTCAGCAGTTTTTCCCGCAGCAAAATCTCGGAGTCAAGACGC
CGACCGTCAAGGACATGGAGCTACCGATCGAGTGTTCTATTGGAAAGGAAAAATACAGAGGACTTGGAGCCGAATTCAAAGACTGGGTATACAGTTCTTG
GATGAACGATGTGCAGCTCAACAGCTCAGTGGGGGTGAATGGCCTGAAGAGTTCAAGATGAGGACCTCAATCGGTATCTCGATGGAATTGCAAGGAAACA
TTTCGATAAGATGAAAGGGATCTGAGCATCAGAAATATGAACGCTTAAATATCTGATGAACAGGATGTTGGAGGTCTACGACCGACAAATTACTTTGGAG
CAAGCCACACGGCTGATGTGGGCAAGAAATCCAGTTGATCGCTCCTGGACGGAGCAATATCAGTACCTGGTTGCCGTTGCAAGTTCGGCGAACTGTCCAG
AAAGTTTTGTGCTTCAGTACATTTGTGGAGGGGCTACGACGAAGGATAAAGCGAGCCATGAAGACGCGACTCGACCGCCGTCCTGCTGACCACCTCAAGT
AGGCATGGGAGATGTCAGATTTTGCCGCAACTGAGCATGATATAAGCGCGAATGTGGTTAGTGCGGGTAGAGAACCTACCGGAGCACGGAA