Description :
From Genome Similarity Track
Location :
Scaffold_432:5656- 13693
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_432-snap-gene-0.81MDa_1 protein
Pytul_var.sporangiiferummaker-pug3_contig_432-snap-gene-0.9Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_432-snap-gene-0.10Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_432-fgenesh-gene-0.2RUN and FYVE domain-containing 2 isoform 1
Pytul_var.sporangiiferummaker-pug3_contig_432-snap-gene-0.14Mitochondrial Processing Peptidase alpha subunit
Pytul_var.sporangiiferummaker-pug3_contig_432-snap-gene-0.12Pseudouridylate synthase

Sequence
8037 bases(100 bases per row)
GTTCGAGTTTGCACCGTTCACGGTCTCGGTGCCCGAGGTCGCAGACATCGACGAAGTGTAGAGTGGGCGACCGCGCCTCTCTGTGTAGCATACTCTCGTG
TCAGTTGGGCATGTAGCCCCCAGGAAGGAAGAAAACCCACCAAGAAAAAACGTAATAATTAATCGCATGTGTACATCTACTCCATTTTCGTCCATTTTGC
TGGTATTTTATGGCTCGAGTGGCTGAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCTAGGTCTCTTTTATTGACAACCACAAGAACTTGTCGCCGAACACTCGGAACGAAAACATATGGACAAAGGGGGT
AGGTCAATTGTTCTTGGCCTTTGGCAGCGCGCAAATCTATTGGGTGAGAAGGAGCCAGTGGGATTAAGGTAAACTACAGATAGTTTGCATTGTAAATTAC
AACTTCAATTATTATTCTTTTGCAGGACAGAGTGAAGGTGTCAGCCAAATGCTGCTGAAGAGGCGTAAAATAATCTTCTTCTCAATTATTCAGTTGTAGT
TTTCTTCGTAAACTACCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCCGTTTTTGGCGTCAGCGTCTTATATTCTTGTGG
GCGTCACGTGGGTTGAACCCTTTTTGGGCCAATCGGCACGCTCAAAGTCGAATTTGCCGTCTGTGTGTGCGCAGCGGGAGTTCAAGCAACAAGCAGCGAA
GCTGGCGCTCCATCACGCCGCAACCGATGGATCTGAAATGGTGCGTTCTGCATGTTTGTGTATATGCGCATGTGTCGGCGCAAGAGGAGCGGACGAGGAC
GAACAGACGAACAGACAGAAATTCTATAATACCAAGACTGTCATTCGAAAGCGGAAAGAACGATACGACACTTGGAGGAATCGATACATGGATAGCGAAA
TATGGCGACGAGGTCACAGGAACGAGTCTTGACGCGAGCATAGCAAGTGGACGCATAAAAAGAGAGCATCGATGTGCCGCGTATTTGCGTGAAGATGCCG
AGAATTCTAAAGAAGTCTGCGTCCTGAGAGGGCGGTCTCTCGACGCCTGCATAAGGAAGAGAAAGACCAACCAGAAAATTCATCCAAGTCATCCAGACAG
ACAGAAGAGATTATGAGGGCTACACGTGGGTGGATCCGACCACTAGAGTTGCTGTTCGTGGTGTATGAAAACAACGCGCTGAGGCGCAATGATCTGAGTT
CCTTGGTCACACAGCTTCCACTCCAAGTTGCGAGCATTATCCCAACAGCACCCATTTTGGTGGTTTTATTTCTTTCTCATGGCCCGTGTCTGTTCGCTGT
TCGTCCCTTCATTTCATAGAATCGCGCTCTGCCTCCTAATCAGCAAAACATACCTTGCCTTCCTCATTGGTTTGATCGACTAATACAACTAACGTGTCTG
TGTGTTCTTGTATGATCTCTTTTTTTTTGAACAGAGCATTCCTCAAAGTGAAGGGAGTTTTCGAGACGAGTTCGCTGCTGGGAACCCAAATCCAACAAGT
TACCTGCGCATCCACGTCCCGAATGACCCCCCTCTCTTTGCCTATCCGCCGCCCGATGCTAATGCTAAAGGCGGACTTTCGCACCCAAAAGCCAGCCACT
TGTTGTCAAGAAAGCGCAGTCTTCGTCCTGATTTAGTGTCCTCGTCGTCTGCATTGCACAATCGAGAATTGGATGTGGCTGCAGCGTCGTCGTCGACACT
TGACCGGAGTGAAATGCAGCTTCCACCGAACACGTCTCATCACCATCACCACCATGACGAAGATTCTTCTCTCAGAATTATGATTCCTGGATTCAAGCGT
CCACGGCGTGAACACGAACACAGTCATGAACCATCGAGTCCCACTTCCGTGGGAGATATCGATGATCCAAAAGCGATTCCCCGCTGTATTCATACAACAA
TGGCGCCACAGGCTCAACCAGTGCAACCACGACTGCNNNNNNNNNNNNNAGTACCAGCATCAGTGGCTCACCAAGCACCAGCAGCAGTTGCGTCAGTGGT
TCGNNNNNNNNNNATTGGCTCCAGCAGTAGCACCTGTTGCACCAGTGGCTGCGAACGCTGCAAAGATGCAGTCTATGATGCGGGGGCTGCAGCACATGTC
CGACTGTCGCTCTGGATGCGTGAATCCGTTGTGCGTATCCACGCGTAATTTCGTGTCCAAAGTGAAAGCGCACATGGATGCGATGCGTCAAAGACCTAGC
CACGATGAAGCAAAGTGTGGGGCGTGTCAGCTTTGGCACGGAATTCTCTCAACTCACGTGCAAACGTGCAAGACGCTAACCTGTTCCGTGCCGCTCTGCT
CTCAACGGAAGGGGAAAAAGTGAAGGCTGCGTGTGCAAGATGGTCAAGCCTTGGATCGAGAAAAGATAAGCGAAAAAGGTAATTTTGGGCAGTAACTACT
TCAGTTTGAGGGGTGTACTTAATTATTGACAGAGAGTGTGAAAGAAGTGAGGAGAGAGGAGAGAGATGTGGTGCAAACTACGATAACATGTCCAAATGAG
AACAAGACACGGTGGGAGGCAACTCTGCTCCCAATGCGATGGCTTTTTTGGTGCGCAAACACAATGTGAATCTTTCTATGGTGCAGTCCTCTTGCCATCA
GGTAAGCCAAGCACCCTGTGATTGGCAACCAAAAAAACGTTTGATGTTTCTATCTTTGGAAGTAGCTTTTCAATCTATCGGCACGACACCGCTCATCTGT
AGGTGCATGGAGTGAGTGCATTCTGGAATTTCACGGGTATACCCTACTGCACGTTTTAAGCAGTAGCAGCTTGTGCGGGGAAAATGGTGCTGAAGTTTTG
TTCAGGGCTCTTTACTACTACCGAATCATCGCGGAACGATGAGGAAAAGGAGGTGAAAAGGAAGGCCACCATTGACGTAATTCTCCTTGATTGCCAGTAC
GACGCCAAGTGGGAGAAAGAGTTCCGAGTCTTTTTCGACGGCAGCAAGTCCACTGGGATCGGATTTCAATGCGCGGCCATGCCTTCCATGCGAAGGTCGT
CTGTAAAATTTAAGAATCGCTGCAGTAATGAGGACGAATACCAGTGTGCGGTGAAGGAAATCTTGCCGAACAGTATAGCAGCAGAGTACAATGCACGCTG
TCGGTCCATTGGAGACTATTCTCGACTTATCAACGAAGGCATCCGTGTTCGGAAAATCGACAATCAAGACGTTGCCGGTGTTCCCTACGATGATGTACTG
CAAATGTAAGTACACAACTCTATTCTGCAAAGTAATTCATCGGGTGCGTGTTGCCTGACGTTTATATTTGCCAGGATGAGGAAGGCGATGCCCGCATTCT
TCTTGACTTTTGTTGACGTGAACTCGAAGCGAGTTGTCTCAGAGCCGACAGACGCACGTTTAGAAAGTGTTAGCGTCCGACGATCCCAGAGCAGTATGAG
TCTTGGTGCCGGGGTAGTGATCACCAGACGCAACAGCACTATTAGTCTGAGCAACCCAGGAACTGGAAATGGCATCATCATCACGGACTTGAGGCTGGCG
GCTCGTCGAAACANNNNNNNNNNNNNNNNNNNNNNNNNCGAGCATCATGGCCGTGCACGGCGGTTCAGTCAATGTCCAAGCGAGTTCCGCTCTTGCGAGT
GATCTGGAGACCAAAACGAGAGATGTGCATGGCAAGTTGCAGTCTGTGGAGAAGCAACTGGCTGACTTGGAGCGCGAGAGGGATCAAGTGATGCTAGATA
AAGTAAATCTCGTGCAAGAGCGTGACTTAATTGCGAGCATGAAGCACGAGCTTGAGATGGAAAAGTTGCAGCTGCTGGAGGAACGCGATGCGATTGTTGT
GCAAAACAAGTTGCTCACAAGTCAGCACCGATCTGCCAGTGACTTGCACATAAGCATTCTGGAGCAAGAACGCCGGGATGCAACGAAACTAAAAGAAGAG
CTTGAAGCTGCGCGAGGCGGGCTTACCCTTCTGCAACAAGCAAACTCGGAGCTGGTGGAGTCAGAGTTGAGTTTGCATGAGAAAATATTCGAGCAAACGC
AAGCCTTCGGAGAGAAAAGCCACGCTATGGAGAAACTTCGTCACGAGAAAGAAGATTTGGAGTTGCAGTGGAAAGAACTGGTTTTGGAGCATAGCGACAC
GGTGCATCACGTTGAAGAGCTTCACTCGAGACTGATCGAGGCTCAAGAGAAATGTCGAGACGCCGAGCTTCAAATTCACTCGCTAAACGAAGAGCTGGAT
GTGAAGACAAAGCAACTTGCAGAGCTAAAGCAAGCCATTAAGGCAGTAAAGCTCAACAACTCCGAACTGGACCGGCTTCTGCGACGAGAAAATGGTACAC
AGCGTACCTCAGCGGCTGCGTCCAATGAAGATCCAGCGACTGATCATCTAACGTTGCTGAGGCAGTTGCTAGACGAGCGTGCAGCCATTGAGCAGCAGCG
TGATGAACTTCTCGTGGAGTCATCTTCTTATGAGCAGGAAGTACAAACGTGCCAGGAGAAAGCCGACTTACTGAGTTCGCAAAATGCCGAATACGAGCAT
CAAATCATCTCCCTAGAGAACGAATTGCACATGGCACGCAATCGGCAGCAAGCACTCCAAGTCGAGTATGAGAATCAGCATCTAACCGTGCAGCAAAATC
TGACTTCAACGCAGGAAGATCTCCTGCGCAAGATCCAGATGCTTAAAGACTCGTTTGCGACGGCGAAAGCTGAAAAGGAGCAGCTACGCGTGGCGTACGC
GGCGGAGAAGGCTGAAAAGGAGCAGCTTCGAGTGGTACTTGATCGACTGGAGGAAAGTGCGCGCGCCAAGTTGGACGCACACACGAAAGAGCAAGAGTTC
CTGTCGCAGTTCAAACTGCAACTGATGAACGGCATCGTTGTGACCAAATACGGTACTCGCGGGAACCCGCACTCTCGCGTACTCTTTTCGGATCCCGGGT
GCCGTTGGATCTCATGGAAGCAGCCTTCCAGTAGTGGTCTGTCGCTCGCGTCACCTCGCTCCGACGCCAAAGTGGAGACGAATGACCTCGTGGACATCAT
CCCCGGCGCCACAACCGAGATCTTTCTGCGTCAAAAGCCAGACGTGCCAGCAAAATGCCTCTCGCTCGTGTTTGTGCACCCGTGCCGGACGCTCGACATT
GAAGCCGAATCCATTGAGAAATGCCAGTTCTACCTTCGCGGATTCCGACTTTTGCACGAAGAAGTTGCACACAAGCGTCGATAGATCACTGCCATACAAT
ACAGCATCTGCTCGTTTGATTTTTTTCTGCCAAATTGCTGTTTAGTTAGGTGTGTTTTGTTGTGTTGGTGCCAGTATTTGCCTGCGGATCGGTTTATCTC
TAGTGTCCTAACCCCTCTTTCAAGCCGCCGAGAACCTGGTCGTAGTTCGGGAAGAGTCTCAAGTCGCCCGAATACACAAGGCTCGGTGGATGCGTCATGG
CTTCCTGGACGATGCGCTGGAGGTCTTCCGCCGTGACCTGATCGATCTTGGCGCACACCGACTCAGGGCTCTCGCGCATCCCGTACGTGAGCAACTGGCG
ACCAATGTCTTCGTAGAGGATCATGCGCGACTCCAGGTTCATGAGCACGGAGCTCTTGAGCTGGTTCTTGGCGCGCATTAGCTCAATCGGCTCGACCTTG
CGGTTCGCGACGCTGAGCATCTGGTTGCAGAGCAACGCCACAAGGTTGCTCGTGTGCGACGGCGAGCACGCGCCGTAGATGCCGAGCAAACCNNNNNNNN
NNNNNNNNTCCGCATGAATCGACGAGAACGCGAACGCCGATTCCACCCAGTAGAAACGGTTCAGCACGCTGGTGTACAGGCGCGAGTACATACCCTTGCC
AGGTCCACCGGCTGAGAAGCTGTCGCCGCCACCCAGAAGCGTGTGCAGCACGCACACGGGGACAAGGTCCTCGTGGTGCCATCCACCCGTTGGGAACGCA
AGCGCAGCATACGAGAACATGGACTCGGGGTTCTCGATCGTCTGGATTCCTCCGGTGTACACGACTGGTTCAAGTGGAGCTTGCGATGCTTCGCCGCCCT
TTGGAATCTGCGAGAAGAACTTTTCAGCCAGTAGCACAAGCGATTGGTGGTCCACACCCGAACCAGCAAGCACCATCTTCTCGGCGACAAAGTGCTTGTT
GCGGAATGCTTGCACCTTTTCCAGCGTGAGCGAGTCGATCTTATCTAATGGGCACTGAAGAGGACGGCCGAGCGATGCGTTCGGTCCATACGCAGCAGCG
TGCACGTACTCCTGGAGCAGCGCCTGCGGGTTTTCTAGCAGATCTTCGGTCTGGAAGCGCATGATGGCCTTGATGCCTTCAATTTCGTCCGGGGTCACGT
CGACATTCAGCACCGAGTCGGCAAGCAATTCGACGCCTTTCACGACGTTGTCGCGCAGCAAATCGATCGTGTAGATGATCTGTTCGCGGCCGCATGATGA
GGTCGTGAGCGCGCCGATGGTCTCGATTTCACGCACCAGCTCTGCGTGCGAGCGCGTCTTCGTGCTCTTGAAGCCCAGGTGCTCCAGCAAGTGGGTCACA
CCGACATTGGAGTCTACAAATGCACGCACAAAGCCAGAAAAATGTGAGTCGTCCGCAAGAATGAGCCAATATAGGATCCGTCACGTACCGTCTTCCAGTC
GGCTGCCAGCGTCGACAAAGATACCNNNNNNNNNNATCGTCGCGGCCTGGCCGTACGTCTCCTGCGAGATCACGCGAAGTCCTGATGGCAGCACCGTAAT
CTCCGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCCGGCTTCAGCTTGGGCAACCTGTTTGAGCAGCACACACATAAACTAAG
TCAACATGATCCATCTACTGCAACTATACCAACAACCACAGCGTGTGAGCACGCACCCTGGCAGCTCTTGGTCCAGCGGCAGTTGGCTCTTCGAGACAAT
GTTCGGGCGCAGGATATCCTTCGGGTCCGGGTGGTCGGGGACGTTGTTCGCGTGCGAGAACGCGCGGGTCTGCAGCGACTGACGGGCGACGGACCGCGCA
AAGGTGGAGGCTGATGGGGCAGTGGTCGGCAGCACAGCCGCGGTCGAGAGCGATCGCGCGAGCGCGCGACGCAGTGCGTGGTTTACGAGCACCATCTCCT
GTCGTTCTTCTGGTGTTCCGAAAAGTGAGCATGCACCCCACAAATTGGTGTTGCGAGATGGTGGGTACCATAGAAAATGGTACAGTGTACCATACTCAAC
GTTGTCGCCCCAGAGTGACAATTACTCATTTAAAACATTTTTGGTTGTTATATACGGTGTAACGTGTCCATCCCATAAATAACAATAGTACCAGATGTAC
GGTACACCTCAAAATGTACCGTTTTGAAGGGTACCGATGCGCTCTTCCAGCCAAATGCTGTGTTGTCCATGAAGAGTTCCACACAAAGGCACAAACAGGT
CGACGACGCGATGGCTGGCAAGCGCAAGACGCACTGGGCCGTGCGCCGCAAGAACAAGCAGGCGCGAGGCGACGACGACCGCCGCGAGAGTTTCCGCAAG
AATGAGCACGTGGACCGCCGCGAGGGTTTCCCCGAAGAAATCCATCCAGGATCGTACGCGGCGCTGCGCAAGGCCGCACTGGACACCAATGCCGTTACTG
CTGACGGCGATGCGGGAGACGCGAGCGCGAAGGAGTCCAAGCGACGCTACGGCATCTGGCTTGCATTCTGCGGCAAGAACTACTCGGGAATGCAGATGAA
CGAGGGCGTCAAGACTATCGAAGCCGAGTTGGAGCGTGCATTGTTTGAAGCTGGTGGCATCTCTGAAGCGAACTATGGCTTCCTGCAAAAGGTATGAACA
CTTTTGTATTGCATGAGCACAAGTGCTTACTTACACGTGGTGCATTGCGTTGTTGTAAAAGGTGGGCTGGAGTCGTGCTGCCCGAACAGACAAGGGCGTC
CACGCCGCTGGCCAGCTGCTGACGGCAAAGCTCCATG