Description :
From Genome Similarity Track
Location :
contig_22:565558- 568201
Transcript NameFunction/comments
g5689.t1ETM51467.1 hypothetical protein L914_04685 [Phytophthora parasitica

Sequence
2643 bases(100 bases per row)
AGATGCACTAAACAAAACACTGAGTCAAGGTCAGTTTGAAAAGATCCGTACTATGATGGAAGTCAGGAACCTCGACCTCAACTAGGAAAACCTCAAATAG
GCAAAGTGCCTAAAGTTAGGATCAAATAAAGATTTTCCGTGAAAAGTCGATTTTGGACTCCAAAACCAAGTTTTCAGTTCAACCACTCAAAGTTATGACT
GGAAAGCAGAATTCCAGTAATGGACTAGGTAAATACAGAGTTTTACATCTAAAGGATCAGTTTTACGGAAGTCCTAACCCTAAGTGAAGCAAAGTGACGT
GACCGCGCTACAAGCCCGTTACTTATGAGTGTTTTTTTTCACTCTTTTTTAGGTGTGACTCTCTAATTTGAGGCTAAGAAAAGCACCTTGGTCAAAGACT
AGGTGGCCGCGAGTTGCAGGATAATCTGCCTTTCCGCGCCGACATTGTCCCCATTGGACGCTGGGCAGTCTGTATGCGCAAAAAGCCAGGAGTCAGTGCC
CACTGTGGCCTAGGCCAAGCTTGCCGTCGTCTGAGAGATTTCGGGCGGCTTACGACCCCCCCCCCCTCCGGAAAGCTTTCGTCGGGACCGAGGCTTGATC
GCTAGACACTCAAATAAAAGTGAGTGGCGAAGGTAAGAGGCGGGAGAATTATGAGAAAGGTGCTCCCTTGAAACCAAAGGCTTTTTGTATGGGCATTAGA
TTAGGATGAATCATTTATATTGGGTACCCACGCTACATAAGCTCTCATTATAACTTCAGTTAGGCTCAGACAATCTTTAATTTGGGAATGAGACAAGGTG
GATCTGAGTCTGCCTTTGAGGTTACCAAAGTCGAGAAAGATCGAGAGGTCGATGGATCAATGGACATCGCTGGCATCATTATTGGGAGTGTTGAGCCCTA
GTATCTACAAGTTTGTATGGTGCTGAATGCAGCGAGGTGATAGGAATAACAAACAAGTAGACTGATTCAATTGGTCACTTAGGCAAAGTGCAAGCGAACC
AATTATCTGGAAAGAGGCCAGCGATCCTCATCACTGGGAATAGCTAAGCCGAGGGATGTGCCGAGGAGATAGCATGTGCCTATCTCACTCTCGAAATTGA
CGGCTACTACCAACAAGAACAAATAACTGCAACAAAGGCGTCCAACCGCTACGCTTGGATGCGGTGGGTTATCAATGTAGTCTGCTGTTTTCGTTTTGTG
AGTCGAAGGAAACCCGCGAGTACGTATACAACTGTTTAGCATTGTGTAATATAGCACTAACATATTATGTTTGATAGATACACGAAACTCAACCCAATTT
CCGCGGAAATCCTCACTACTATCATGGAGGCGGTGACGAAGGCTATGGAGAACGTAATCGGTGTTGAGACCCCAGAGTCGTTTGGCTTCATCATCGATGG
CTGGTCTCATGGTACTGAGCACTACCTGGCTGTCTATGCGTGCTACGAGACAGAAGCCGGGTCTCAATTCCGCTTCTGTCTCTGGCACCCGTGATGGATG
AGCCCGATGACCAGCTAATGCAGAGGGTCATCTTACGGCTATGAAGCGGTTCCTCCCTTTTTCAGTAAGTCGATTTATGGGTGTCTGGTTTTAGTTGGGG
ACAACTGCGCAGTCAACAAGCGGCTTGCCAACCTGCTTGGAGTGCCGCTCGTTGGCTGTGCGTGATTACTTGGGACCACACGACAACATTCTCGAGGAGG
TGCAACAACTGATGCGCAAGCTGCGAACGCTGAAGCAAGCGTGAAACTACGGTACTTATCATTCTCGTATTCTACTATTTTGTCTGTGATACGGGTGTGC
TAATATTTTGTAATGTAATATTACTATTTTAAAATAGTACCCAGTCGTCTCTTGCTGCGATACTTCGACAAGACACACGCTGGTGTCGACCTCTCGATGC
TCAAGCGTTACTTTCGGCTCCGCGAGTTTATTTCGGCCGACGATGAGGAGCTGGAGGAGGACTATCTTCCGTCTCGTACGGTACACCGCAAGCTCGAGGC
TCTGCAAACCAGCCTACGTGCGTTTCCAAGCGCCTACAAGTCACGAGGCTTACTTTGCTGAATGCGCGTGATCTGTCCGATGGCCTGCTGGAAATTCGAC
CGTCGTTAGCGAAGTATCTCGGTAAGAACGTATGTATTGTTATTGACTAACTGTTATTTTTGTATTATAATATGTACCCATGTATTAGCATCTGATGCGG
ACATCGTGCACTCTATCGTGTTTGAAGAGGCAGTGGTGACGGTCTTGGTTGGTCTAACGCCGCTTACTTACGGAGGATGAAGTGGCGGCTTTAGAGTCCT
TCAAGCGGGAGCGCAGCAGCATTTTGGTTTCAGTGTACCCCCATCGACCAAGGAAGGTTGGCTGAGCGGATCCTCAAGCGTCGCAAGGTGGCTGCCCGAG
CCGTCCATCTACATGCTGCAGGGGCGATACCTCCAACCTCCAATATGGTGGAGCGCCTCTTTAGCGTGGCTCGTGCCGGTTTGCGCCATGAGCACCATCG
CTTGTCTCTCTTGATGCTGGAGATGATTCTTTTTTGAAGGTGAACCATTGTCTGTGGGATGTGGCGACTGTCGAGCAGTGCATGTAGGAGATGAATTTGG
CGAACACTATTGCAATTTGCTGCTCTAACTCTTGGATTGCAGT