Description :
From Genome Similarity Track
Location :
contig_22:565510- 568153
Transcript NameFunction/comments
g5972.t1hypothetical protein

Sequence
2643 bases(100 bases per row)
ATCACTGTTACTTACGGTAGCACTCATGATATGATTCCAGATGCACTAAACAAAACACTGAGTCAAGGTCAGTTTGAAAAGATCCGTACTATGATGGAAG
TCAGGAACCTCGACCTCAACTAGGAAAACCTCAAATAGGCAAAGTGCCTAAAGTTAGGATCCAATAAAGATTTTCGGTGAAAAGTCGATTTTGGACTCCA
AAACCAAGTTTTCAGTTCAACCACTCAAAGTTATGACTGGAAAGCAGAATTCCAGTAATGGACTAGGTAAATACAGAGTTTTACATCTAAAGGATCAGTT
TTACGGAAGTCCTAACCCTAAGTGAAGCAAAGTGACGTGACCGCGCTACAAGCCCGTTACTTATGAGTGTTTTTTTTCACTCTTTTTTAGGTGTGACTCT
CTAATTTGAGGCTAAGAAAAGCACCTTGGTCAAAGACTAGGTGGCCGCGAGTTGCAGGATAACCTGCCTTTCCGCGCCGACATTGTCCCCATTGGACGCT
GGGCAGTCTGTATGCGCAAAAAGCCAGGAGTCAGTGCCCACTGTGGCCTAGGCCAAGCTTGCCGTCGTCTGAGAGATTTCGGGCGGCTTACGACCCCCCC
CCCCTCCGGAGAGCTTTCGTCGGGACCGAGGCTTGATCGCTAGACACTCAAATAAAAGTGAGTGGCAAAGGTAAGAGGCGGGAGAATTATGAGAAAGGTG
CTCCCTTGAAACCAAAGGCTTTATGTATGGGCATTAGATTGGGATGAAGCATTTATATTGGGTACCCACGCTACATAAGCTCTCATTATAAGTTCAGTTA
GGCTCAGACAATCTTTAATTTGGGAATGAGACAAGGTGGATCTGAGTCTGCCTTTGAGGTTACCAAAGTCGAGAAAGATCGAGAGATCGACGGATCAATG
GACATCGCTGGCATCATTATTGGGAGTGTTGAGCCCTAGTATCTACAAGTTTGTATGGTGCTGAATGCAGCGAGGTGATAGAATAATAAACAAGTAGACT
GATTCAATTGGTCACTTAGGCAAAGTGCGAACGAACCAACCATCAGGAAAGAGACCAGCGATCCCCATCACTGGGAAAAGCTAAGCCGAGGGATGTGCCG
AGGAGATAGCATGTGACTATTCACTCTCGAAACTGACGGCAACTACCTACAACAACAAATAACTGCAACAACGGCGTCCAACCGCTACGCTTGGATGCGG
TGGGTTATCAATGTAGTCTGCTGTTTTCGTTTTGTGAGTCGAAGGAAACCCGCGAGTACGTATACAACTGTTTAGCATTGTGTAATATAGCACTAACATA
TTATGTTTGATAGATACACGAAACTCAACCCAATTTCCGCGGAAATCCTCACTACTATCATGGAGGCGGTGACGAAGGCTATGGAGAACGTAATCGGTGT
TGAGACCCCAGAGTCGTTTGGCTTCGTCATCGATGGCTGGTCTCATGGTACTGAGCACTACCTGGCTGTCTATGCGTGCTACGAGACAGAAGCCGGGCCT
CAATTCCGCTTCTGTCTCTCGCACCCGTGATGGATGAGCCCGATGACCAGCTAATGCAGAGGGTCATCTTACGGCTATGAAGCGGATCCTCCCTTTTTCG
GTAAGTCGATTTATGGGTGTCTGGTTTTAGTTGGGGACAACTGCGCAGTCAACAAGCGGCTTGCCAACCTGCTTGGAGTGCCGCTCGTTGGCTGTGCGTG
ATTACTTGGGACCACACGACAACATTCTCGAGGAGGTGCAACAATTGATGCGCAAGCTGCGAACGCTGAAGCAAGCGTGAAACTACGGTATTTATCACTC
TCGTATTCTACTATTTTGTCTGTGATACGGGTGTGCTAATATTTTGTAATGTAATATTACTATTTTAAAATAGTACCCAGACGTCTCTTGCTGCGATACT
TCGACAAGACACACGCTGGTGTCGACCTCTCGATGATCAAGCGTTACTTTCGGCTCCGCGAGTTTGTTTCGGCCGACAATGAGGAGCTGGAGGAGGACTA
TCTTCCGTCTCGTACGGTACACCGCAAGCTCGAGGCTCTGCTAACCAGCCTACGTGCGTCTCCAAGCGCCTACAAGCCACGGGGCTTACTTTGGTGAATG
AACGTGATCTGTCCGATGGTCTGCTGGAAATTCGACCGTCGTTAGCGAAGTATCTCGGTAAGAACGTATGTATTGTTATTGACTAACTGTTATTTTTGTA
TTATAATATGTACCCATGTATTAGCATCTGATGCGGACATCGTGCACTCTATCGTGTTTGAAGAGGCAGTGGTGAAGGTCTTGGTTGGGCTAACGCCGCT
TACTTACGGAGGATGAAGTGGCGGCTTTAGAGTCCTTCAAGCGGGAGCGCAGCAGCATTTTGGTTTCAGTGTACCCCCATCGACCAAGGAAGGTTGGCTG
AGCGGATCCTCAAGCGTCGCAAGGTGGCTGCCCGAGCCGTCCATCTACATGTTGCTGGGGCGATACCACCAACCTCCAATATGGTGGAGCGCCTCTTTAG
CGTGGCTCGTGCCGTTTTGCGCCATGAACGTCATCGCTTGTCTCTCTTGATGCTGGAGATGATTCTTTTTTGAAGGTGAACCATTGTCTGTGGGATGTGG
CGACTGTCGAGCAGTGCATGTAGGAGATGAATTTGGCGAACAC