Description :
From Genome Similarity Track
Location :
Scaffold_720:5655- 9945
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_720-snap-gene-0.9Protein kinase
Pytul_var.sporangiiferummaker-pug3_contig_720-snap-gene-0.12Ubiquitin carboxyl-terminal hydrolase and/or F-box protein

Sequence
4290 bases(100 bases per row)
AAGCGCTACACGGTGTTCCAAGTGTACGTGCACTACCAGAATGGCCGCGTGACGATGCTCGAGANNNNNNNNNNTACAGCCACTTTCGCGAATTGCACAA
GACGCTGCGCCACAAGTACGCCGCGGTGAGTAAAATGTATTTTCCGCCCAAGAAGTTCTTCATGTCGCTCTCGCTGCATGTGATCGAGCAGCGCCGTGAA
GGCATCGAGAACTACATGAACGCCGTGCTCACGCTGCGACCGCGGCCTGCAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACATTGCGAACCTCAGAGGCAGCAACGTGACGCCGGCGAGCGGAGGCAGCATGTCGTCGT
CGTCTGGTCCCGGGAGCTCGGGACAGTTCATCACGATGACGGACTTTGAGATCCTGAAGATGCTCGGCAAAGGATCCTTTGGCAAGGTGTACATGGTGAA
GCGCAAGACGACGAGCGAGATCTTGGCGATGAAGGTGCTCCGGAAATCCGAGCTCGTGAAGCGCAGCCAGGTGAACCATACGATGACCGAGCGCCGCATC
ATGAGCTCGATCGACCATCCGTTCATCGTCGGGCTCCGTTTTGCGTTCCAAACCCAGAGCAAACTGGTCATGATCTCGGATTACTGCTGTGGCGGCGAGA
TTTTCTTCCATTTAAAGAAATTTCGATCGTTCTCGGAAGCCATGGTGCGGTTCTACGCCGCGGAACTGGTCTCTGCGATCGGCCACTTGCACTCGCAGGA
CATCATCTATCGAGACTTGAAGCCCGAGAACATTTTATTGGACGAAGACGGACACATTCGGCTCACGGATTTTGGGCTCTCGAAGACCAATTGCACGGAT
TTCTCTGGCGCCAAGACGTTCTGCGGCACGCCCGAGTACCTCGCGCCCGAGATGCTCATCAGTCGCAAAAAGAAGACCGAGTACGNNNNNNNNNNNNNNN
NNNNAAGCTGTCGACTGGTGGAGTCTCGGCACGCTCATGTACGAGATGCTCACGGGGTGGCCGCCGTTCTTTGACCGCAACATTGAGCAAATGTGCACTA
AGATCATGAAGTCGCCGCTCAAATTCCCGTCGCATTTTGGTCTCAGTGCTGAAGTGAAAAGTATCATCTCGGGCTTGCTCGAGCGCGATCCAACGTACCG
CCTTGGCTGTCGTCCGGGCGGAGGCGTCCAGGATATCAAGAACCACCCGTTCTTCGCCGAAATCAACTGGACCGTCCTGGAAAACCGGGGTGTGAAGCCG
CCATTCAAGCCGCGCGTGCGCAGCCCAACCGACATCCAGAACTTTGACCGCGAGTTCACGAAAGAAGCGCCGGACCATCAATTCCTTCAGGTGCGTGGGT
CACAATTTTTGTTTATGATATGGTGGTTGACTATCAAATATTAACTTGTGTGCTGTGCTCAATTGTGCCTTTGCAGCAAGACAAGCGTTTGATCGTGTCG
CCAAAGAACGAATTCAACGGGTTCTCGTACACACCAAAGACGGTCTCGTCGTCCAAGTCGCGTAGTTCGGATTTCCGATTAAGCGGCGAAGGCTACGACA
ACGGTGTGCGCAACTTTTCGATCTCATAACCAGTTTCATTTTGGTTTTGCGACTGCAAAAATGAGAAGAAAAAAAAAAGAAGAAAACAAACGACGAGAAC
CGCGTATCGGGTGGAGAGAAGAAGAGAACGTGCATTTTCTGTGAATATTATGTATATGGGTGGCTACGGACTGTGTAAAATTGAAGAATGACGATAAATA
AAATCGAAGCGATGGAGTGTGAAGACGGAAGGCGAAGCGCGTGCGGCGATCACACACAAGTAAAATGATGGATTTGATAAATTGGTTAGAGTACAAACAC
GTTTGAATATTTGAAGTTGTTTATGCTGCTGTCGTGTTTCTCACGCGTATTTTCACTTTTGCGTATTGCTACCTTGTGATCATATTAGTGTTTATGTTGT
CGTTCCTTGTTCGTCTATTTGATAACTGCACTGGTTTGCTTCCCTTGTGTATGTGTTTGTGGATCCATGGAAGATCGATAATATATATGGAGGGCGTCCA
TACGCTACTTGACTTTGGTTTACTGCACATGTTCCTTCTTGTTTCTGTTATTGGATGGCCATGAAGGCGGCGTCTTCGGGATCATGGAGCCGCCCGTTCT
TGTCCGGTCGGTACTGGTAGAACACGGGCATCATCTCGCGCATCTGGTGCGCCACCTTGTGCTCCTTGAAGTCGTACACACGCTGCCATTTGCCGTCGCG
GTTCGCATACCGGTGGTTCACCTCCTGACATTGTGCTGCATGAGAAACCAATTTCACAATGTTAACTTTTTTTCTCACTCAAAACCGCAATTTTGTCCAT
ACAACAACAACAAAAACGTACCATTGCAGGCTCGGCACAAGTCATAATCGGCGCATAACGAGCAGTTGAAGCGCGGGCCTTTGAAGTCCGTCTCGCCACA
GGAATCGCAAATGAAGCCCAGGTGGCGGCCTTCCATGATGTACTTGAGCGTGCGTCGTCCATCTTCGCTGCACTTGCGAAACGCGCTGCGCACGCGGAAT
TTGGGGATGTCGAGCTTCTCAGCGAGCGTCTCGATCTGCTCTAACGTCGGCACAGCGAACGAATCCTGCACCAAGGACTCGGCGTGCGCATATTGCGTCC
ACAGCAGGTTCTCCATTGTCGCCACGAACGCGTTCTGGGCACAGTGGCCACGAAGTGTGAAGATCACAATGTCCGTCGGGTGCAGCAAGCTGTCATCGCA
TGTGTGACCAGATTGAGCCGCCATGACAGGCTTGTCGCTCGATGCAATGGGACCTGAGACCACAGTCGGCGCGATTTCCTCTTTGAACATGAGCAGCTCC
GACGACGCGCATCCGACGTGCTTGGCGACGCACTCGTAGATCATACTCGTCGTCAAGTGTGCTGCAAAGTTGATGCGTCCGAGGTATTCGAGCTGCTGGG
TGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGTCCATGATCTTCACGAAGAGGTATCCTCTGTCATGGCCATTCGCACAGGACACAGTCGA
GTTTGTTTCCACGTCCATGGCCGAGAAAATGCCATCTTCATTGCTATACGAAGTTGCTATTGTCGCGCACTCGAGGGGCGCATCATCGTCCACTTTGCTT
TCCACATAGATCTGGCAAAACGAGTACGCGTCAATGTCGACGCCGTCGCAGAGCAGATTGCTAAACATGGGCTGACGCGGATCCACGCTCGCATGCGTGA
GCAGCTTCCTCGGTCGCAGCGCCTGGCCTGAGACCACGGGCTGGTTGAAGCACCACACGTTGACTTGGTCGCTCTCGATGTCGTACTTTGTATGGAGCGC
CTTGAGCAGGTCCTGAAGCGTGCAGCAAAACGGCAACTCGATCGTGTCGACGCGCGCGAGATCCGTGAGCCCCAGGTGGTGGTGACGCTTCATGTCGTGC
TCGNNNNNNNNNNNNNNNNNNNNNNNNNCGTGATGCTCATCAAGCGCACCTTGGCCGTGACAGTGAGCGTGTTATCGTGCTGTAGGAAGCCGTTCTCCGG
GTTCGTGAGGTTCTTGAGCGCGCCGAGCGAGTGCACGCCCCAGTTGTTGAGCTGGTGGTCGAACTTGTTGTCGACGAGGCACGAGTGCCATTCGATGCGC
TTGCTCGGGTCCACGTGGTTGACCACCGAGAGCGAAAACACCGCGCACGTGAGCCAACTCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTACACGCTCAACACTTTGCCCGCATACTGCGGCTCGTTCGGGTTGCCATTGGGGAAGATCCAGAGGCAGAAGTGGTGTTCGCC
GATGGAAAACGTCTCCGAGACGATCTTGTCCACGTCGGTCGTCGCTGCGAGCGCAGGGAACTGCGGGATCTGCACGCGAAGCTCGGCACGCGCGTTGAAC
TGGTGCTGCTCAACGAAGCACCTGCGCCAGCAGCCGCCATACAACCGAATGAGCTACTCGCATATACACACAAAAGACATATTGTCAGTATCAGCTTCAG
TATGGCAAATGCGGACTGATCAACGAAGACGTACGTCATAGTCGGGGGCACCAGGCAACTGCGGCAAAAACTGCGTCTGCAACGTCGGCCACTGTTGCAT
GCAGATGTTCTTCCACACGTCACGGTCGTACGTGAGCGGCGCCATGGCGCGGCACACAAGTGCGCACGCGAGCAGCGAGCCACCGTCCAG