Description :
From Genome Similarity Track
Location :
Scaffold_1224:5655- 7749
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1224-fgenesh-gene-0.0Chromodomain protein

Sequence
2094 bases(100 bases per row)
CTTGGATGGGCNNNNNNNNNNGTGTTCGCTTGTTTTGTTTTGTGTGGCTGGTGGTACCAGTAAGGCTGTTCTTGTNNNNNNNNNNTTGTTGTTGATTATG
GCCGGGACATGTTGGCTGGGTAGGGACGCCATCGTACATTTCGCTTAACAGCCCCCATGAGTCTTGGGTGGGCTCGGGGTCTTTCCACGAGACAAGGAGC
TCCCACATGCGCGTGCGCGTGTTGTACTTGTGCGCCACGATCGCATTGACCGCCAACGTCATGCCTTGGCGCGACACGTGCTCATTGATCTCCTCAGTGA
CGTCCAAGTCGGCGGCGGCAAAGTACTTGAGGCGTGACGCGTGCACTTCGTACTTGGCGCCGGTCAGCAAGTGCTCGATCATAAATGTAAAGGGACGGGC
CTCGGTCACACCAAATGGGCCGAGCCAGGTCACCATGAGCTTGTTGCTGTCAAGCCGCGAGTCTACTCGAGACCATAGTACATAGTCACCAACGTGAAAA
TTGCAATTGGTGCCGTTCTTNNNNNNNNNNAGGTGCCTGTCGGGTCGGCAAGGCTTTGTGGATGCCTCCCGTCGATGATGCTGTTGAAAATGCGGTTGTA
GATGCTGTTGTTGTTGACGCGGGCTAATGTTGATGGTGTTGTTGTTGATGGGGGTTCATGTTGATGTGGGTTCACGTTGATGGTGTTGTTGTTGATGCGG
GTTCATGGTGATGCAGGTTCATGTTGATGCGGGCTGGTGTTGATGCTGTTGATGTTGTTGTTGGCTGGGTAGGTCTCGGCTCGCCTCCACAGGCTGGTTG
ATTTATCGCGAGAGGTCGCGGAGGGCGGCTTCCAGGTAGATCGTGANNNNNNNNNNTGCATGCGCGTGTTGTACTTCTGCGCCACGATCTCATTGACCGC
CGACGTCATGCCTTGGCGCGACACGTGCTCGTTGATCTCCTCAGTGACGTTAAGATCGGCGGCGGCAAAGTACGTGAGCCGTCGCGTGTACTTCGTACTT
GGCACCGGTCAGCAAGTGCTCGATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCATCATGAGGTCGTTTGCTTCTGT
CGGGACCCACACTTTCTCGTTGACGTAGATCACGCCATCCTCATCACGCCAGTGGTCGACAGCCAAAGGATCGATGTGGCGGTTCTGGGCTTCGCCTACG
CGATCATAATGGTCATTCAAATGTATCCACCTGTAGAGGGCGAAGGTCACTTTCGTTTCCTCTGTGTCTAGTGCTCACCGCCTTGGAGACATGCTCGTTG
GCACCGATCGCCGTCGGTATCCACCGTGGAATGAGGTCCGCCCACACGTTGTCACTGCCGGCAATGTGCTCAGTGTCTGTTAAAGTTAGAGGAACCGGNN
NNNNNNNNGACGTTGCTGGTAAAGGAAGGCAGTGTAGCGCCGCCGTCGCGCAGGGACAGTCGTGTGTCCTACAGCAGTAAGCGTATTAGTCGGACGTCAT
CATCTGGTAGAATCTGCGAGAGAACGGATAGAAGCTTGTCACGGTCGATTGTGTCGAAACCACGAGAGAGGTCGATGTCGAGGATGTAGAATTCTTGTCG
GTAGGGTTGCGCTCGCGCCGCTTTCCAGCGGTGCGCCCAAACTGCGTCTGCAGTCCCGCGGGAAGGGCGGATTTCGCTCTGGTGTGGAGAGATGTTTTTG
TGTATCTTTTCTCTTTGGTGACTTGGGTGAACTGACNNNNNNNNNNGAGTTCGCTGGGACTTGGAAATTTCTTGAAACTTCATCACATGTAGCTTCCAGT
GTCGTTGCTCAAGACCAAACACCTCAGCATCCACATTTCGAACGTCCTCTTCTCGGGTCTGTCCAGCGACAGGTTCGCTACTATCTGCAACCGATCAGTG
GTGGAGCACTGAGAATTTTCTCAGAGTCCAAACATCACTGAGACAGGGAGTTGCCATAGTGAGAAGAAAAAAAAACAGAATAAAGACAGTACGA