Description :
From Genome Similarity Track
Location :
Scaffold_1695:5655- 7516
Transcript NameFunction/comments
Phypl_g13984hypothetical protein

Sequence
1861 bases(100 bases per row)
GGGTAAGTGTGCTGGCATCGTGACAGCGCGTTCTCTGTTGGTCAGCTTGCTGTGCCTTGCCTTGTCCAAGTGTGCGCCATCCAGGCACAGAGGCGGCGAA
GCACCACCAACGATATAATCACTGGCAGGATTAGAGGCAACACACGTTCAAATGGACCgcgccgacgacgtgcaACGGTGCTCGCTGTATTCCTGTCCGC
TCTCCCTTGCCGAGCTGATGGACGCTCAGCACCAGCCTTCTCAAGCCAACCATGAAGCGGACGCTGCGACACCAAGCGGGTCGCTAACAGGGCCGATGGA
CTGGAGCAATATCAGCCCCTCAATGCCGCGCGAGGCTCAGGGAGAGTACATGTCGCTCTTGACTATCTCTCCGGCCGGCCCGGTGCAAACTGCTTCAGTG
CCAGAGGATGATGCAGAATCGGCGACAGCTACCTTCGGTGGGGAGAAGGTAGCCCGAGGCGTGATGACAGGGGAGAAGCAACGCCCTTCAGCAAAGGAGA
AGGTTGCACCCATGGAGGAAAGAAGCTCAGGGAGAATGAAGAAAGAGTTGCAGACAAGAGAGGCTGGTGAGAAGATCCAAACAAGGGCTCACGCTGCGAA
AACCAAGCCGAAGACTGGCAAGCGGCTGAAGTGGAGCAACGCTATGGTAGCagagctgcttcgccttcgttTCAAGGACGACGAAATGAAAAACCGCATC
GACTCCGCGGATACCAAGACCAAGGCGGCGCTTGCCTGGCAGTTCTTCGCCAGCAAGCTGTCGCAGGTACTGGGGCTAGTCATCACCCAGGAACAGGTAC
CTACCCTTTAAAATTGCTAACTACCACTCCGTTCCAGATCACTTGTCCACTTTTGCTAGCGCAGCTCGGGATTTGTCAATATTGCTCGGAAACGACTGTG
GTTGGGATTAAAAGAGATCTGGCGTCGGCGTCATTGGAATGGTGTGCGGTTCTCCAAGAGGGAGTCCGTATTGGCGCCTGGGTGGCCACGAGAGTTCTTT
TGGAAGCTTCGCCGGGAGGGGATACTTCCTTTGAACAGTCCCTTCTCTGTCTTATTTGTCTCGGTTATACGTGCGTTAGGTAGCACACACCATCCAACCA
TAGTTAATCTTAGTATAAATGGAGGACAAGTAATCTGAAACAGGTCAAAGGAGTCCATTTGAAACGGAATGATCGTTAAGCTGTTTGTGAGTTTTTTTAC
TAGAGGGTTTTGAAGTTGCGCCATCGATTTTTCGTATCTAAACGGGAGGCGAGAAAACGGTGGAAAAGCAAACTACTCCAGATCGAGGCATACGATACGT
TTGCCAAACTTGCTCCAGATATGCATATAAGGCATAGATTAGATTCCGGTAACAAGTACCACTCTGTTCCAGATCACTTATCCGCTTCAACATTTGAGTC
CATTCAAAACCAAATGATCGTTAACTATTTAACCTCAAATTGGAGTTGCGCACACCATTGAAAAGCTGAGCGTCTGGACTACACGACAGAGCCCTTGCTT
GCCAAACCCTTGGGTAGAACAAACGTTATGGCGGCTTAAAAAAGTATCTCCTTGCTGAAGGCATGTGGTCGAATTTCTTTTCTTCGGTCAAACTGATCTG
CAGGCAATTGTGAAGCGAACAACGTCTTCTAGAGCTCCTAGCAAGGTCTAGAACCGTTTGAAAAAGGCACGTGAAAGTCTGCCTTCGTTAACGATCATTT
TGAATTGAATTCCTGGTTCCATGTCCAACACATGGTTCAGCCAATTAGATGACGGCTTCATTGACGATTTGACTTCTTGTTTACGGCTAATGAAGGCCCC
CGACACACAACACCAACGACCGGAAGCATGTAGGCGAAACGTCTACGCTCTTTAGATGAAG