Description :
From Genome Similarity Track
Location :
Scaffold_532:5655- 6658
Transcript NameFunction/comments
g2326.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GGCACGCAAGCCTTTCAAGTCGACCAAGGAGGGACTCGAAGCCAGGGAGAGCGCACGCAAGGACACCACTGTGTGCTCTGATGTGTTGGGGCCCGTCACT
CCTGCATCCAAGTCGGGCTACAAGTACATTGTAAGCTTCATCATGATGAAGAGTCGCTTTGTGACAATCTACCCACTGCGCAAGAAGAGCGAAGTGTGTG
AGGCGTTCAAGAAGTTTCTCAAGGAGGCAGAAACAAGTGCGGGCATCAAGGTCAAGGTGCTACGCAGTGACAACGGCGGTGAATACTGCAACGCGGGGAT
GGTGGCTCTGTGCGACGAGAAGACCATCAAGCAAGAGTTCACGGTGCCTTACAACCCGCAACAGAACGGCATGGCAGAGCGGATGAACCGTACGCTGGTC
GAAATGACACGCTGCATGCTGGAGGAGAGCGGGATGGACAAGTCGTACTGGTGCGAGGCCATCATGACAGCTGCAGACATTCGAAACGTGTTGCCTAACA
CGTCAAGCCCACACGCAAGCCCATTCCAGCTGGTTTTCAAGAGGGCGCCACGTCTGGAGCACATGCGCGTTTTTGGGACCGAGTGCTACGCCCATGTGAC
CAAGCAGAAACGCAAAAAGCTAGACAACTCGGGGATCAAGTGCGTGTTTCTCGGCTACGCCAAGCAACACAAAGCATATCGACTCCTGGACCCCAGCGAC
GGATCGATCGTGATTTCAAGGAGTGTGGCGTTTGCTGAAGCGCCACCGGTCACAATGGCGAAGACGCGCAACCAGGAGGTGATCGACATCATCGACAACG
ATGAAGAAGAGGAGCGCACCGAAGAACCCAGTGTTGACGACGGTTTCAGCACGCCCCCGACACGCCCACTCCACGAACCGGAGGAGCACAGCGGACCGAC
CGGATCTGTGCCAACGCGTGGCTCTAGCACGCCAGGGAGAGACGGCGAAGAGGAGTGGATGGTGCGTCCGGCACGCAAAAGGCGTGGAGTCGTGCGCTAC
CAA