Description :
From Genome Similarity Track
Location :
Scaffold_35:5653- 6856
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_35-fgenesh-gene-0.0Acid phosphatase

Sequence
1203 bases(100 bases per row)
GATTTCTCGTCAAGCGTTGAAAGCCGCAGAATACGCAGTGCAAGCAATGCAGGAGCGAGCGCGCAAGCGACCAGGGAGAACGAACCAGCGTTTGCCATAC
TGGGCTGCACAGCTCACAGAAGAGCGTGCATTGTCAGTCGAAGACAGAGCGAAGACGCATCAAGTGCTTGCTGACCGGGTGGAAGAGAGCGTGATGGATG
TGGTGGCCATCTTCATGGCGAACCCAAACTGTCCGCTGCACGAAGGAGCAGTTCGAACTCTTGTTCTTGCACTTGAAACGGTGCTCAGAAGCGGCATCAA
GGAAGATTACGTCGGTGATTGGCCTGAGGAGCCATACTACGAGTTTCTGGCAGAAATGTCTACTGTTCTGCGGGACGATACCGGTGTCGTGGCCGAGGTG
GAGGCACTGACGATTCCCGTACACCTCCAGTGTCTTGGATGGACACACTCCCGAGCGTTGATCCTGGTTGCATTGACCAGAAACATGTTTCACCGCGCGT
TCGAGGTACAGTCTGGCAGTATCATTCCATGACATCGATGATTGAAGCTAATTCTCAACTGACAACCAGAACCTGACCAAACGACGTGCACTGATCGAAA
AGTACTACGACAGCTATGCGCTGGTCTACGACTACCCGACGGCAGCAAAGATCACATCATTCTTGAGCGCATTGAATGCCGTCCAGTTTCTCCTCGCTCC
GTTTCCGATGTTGACGGATCGAGACAGCATCGACCCGCAACGATACCCGCTCAATTTACAGCAATGCTCACCGAGTGAAACATTTGAGAGTGACACGATC
TCATTCCTCGACGGTATCACTGGCGATGGACGAGTTACTCGAGGTATTGACGCATCTCCGGACGAGATGAATCATGTTGAGCTGTGCTCGATTTCGCGCT
ATCTGTTGCATTCGACCCCCTTCGAAGAGCTCACCATCGGGTATGCGATGTGTATTTGAATCGTGAAGTCCACTGAACTGACACCGTCGTGTATGCTTAT
CAGGAGAGGATCAACAGAATCGCTGCGCGTCTACCACTCTGATAGCGACGACTTCGTAATGGCTACACAAATCAAGGTCCACGCGCAAGATATCTTACTC
TCGGTAGTGGATGGCGACGGTGGTGGAGAATTGACAGAGTCACTGCGCATCGCAGCTACCGATCAATGGGTTGAGCTCGTGCTTCGCTTTCATTCACCGG
GGT