Description :
From Genome Similarity Track
Location :
Scaffold_125:56515- 58633
Transcript NameFunction/comments
Phyta_totarag4132hypothetical protein
Phyta_totarag4133hypothetical protein PHYSODRAFT_285441

Sequence
2118 bases(100 bases per row)
GGAGAATGGATTAGTCGTCCTTACAGGACTCGGGGGGAGATCCACGTCACCTATGACGTGGAGCATGCGCGCTATGAAGGACTACCGGATGCGTGGCGAA
CATTGAACCATCAGTTCGGCTTACCGCTTGAGGAAGTACTCAAGCGGGAGGTAGAAGGGTACGAAACCAAGCTCCCCGCAGTGCTGGAAATGATGAAGAC
TTGCTTTCTGGCACACGATGGAGCTTACACGGAAGGAGTATTCCGCGTGGCACCAGACAAGACAGAATATAACGCGGTCAAGAATGCTATCAATGACGGA
TCGTTCGAGGACTGCTCCGACGTACACATTATGGCCTCGCTCATCAAGGTTTGCCACCAATGAGAGAATGTGCGGTTCGCAGTTgtcctcatcttcttgt
TATTGCGTGCATGCAGGTTTGGTATCGAGATCTCCCTGTAAGTTTGTTCAACATGCTCCCGGAGAAACAGATTTCTCTCACTTGCGAACTTGTGGTAGGA
AGTTCGACAGCAATACAGTGAGAGTTTGCAATGGATTGAGTTTGGGTGACTGACGAGCAGAACTGTGCTATGTGGTGGCTTTGGCGTAGGACCCAGAGCC
GATGGTAGTGTTGCAGTCCCTGACGGCACTGCCATCACTGCACCAAAGCGTTGTGTTATGGCTACTAGACCTGGTGAATGAAGTTGTGAAGCACGACCAC
GAGAACAAGATGACCGCCAAGAGCATGGGTTCGTCCTCCATCACTTTCACCGCGAGTTGACAGCAGCTACTTAAGCTACTTAACCTCTCTCCTCCTCTCT
TTTGTCGCAGCAATCGTCATGGCACCGAACCTGCTCAGTGTGAAGAACACCTCTGATGCTGCGGTCGTAGTCGCGGAGTACAGACAAGTAGCCGATTTTG
TGCAACTGCTGATGCACGCCCGCTCGATCACAAGACTGTCAAGTCCACAATGAGGACGCAGGAGAGAGCTAATGTAGACGCAACGCTGGCGGAAGTCGTT
TTTATTGATATCGTTCGGAATAATTTAAAGCTCAATGCAAAAGGAAGATTGCTAGCAAAAAAGAAGGAGACTGCGAAGTGGACAAAGCTGACTGTCGACA
CATCTATCTGAGCAGAGGCTACTACCTGCGTGTACCTACACAAGGCAGCCGTACTCGGGGGAGATGTGGCGGAAGATGTCGTCCTCTAGACCCTCGAGTC
CACTAGGAGCGATCGCAGCTGATGGTTCTTCCTGGgtcgaggtgctggcggcCGCGGTCTGCTGGGCCATGGCAGTTGCTTTTCGCATGGCCATGgtcgg
cgacggctgcagcgGGAAAAAGTCGTACGAGACAGCATCGAGAGAGTAGCCGCATGACGGGTGATCGTTCTCACCATAAGGGTCCATGGTCGAGGTGCTG
AGCTCGCCGAACGGGTCGTACAAGGCGTCGAAGACGAACCCCGGTTGTGTGGGGATCATCCCGGCGTTGTATTGGTTGTACTGTGCACGGCTGTAGTCCA
TTGCCGCGTTCATGGCCATGGGGTTGCCGAAGAACAAGTTGTCACGGTGCGgcgaggaggcggaggccGAGGATGGCGAGTCCGTGAAGAGGTGTTTGCG
TGCCTTGTTCCTGTGTGTGAAGTACTCGGCGCCTGGACGCGGACTCTGCGAGCCGCACGagtcctcgtccgagtcgtGGTCGTCTGGAGtgttgctgccg
tcggcgtcgccgtgGAAGAAGTGTGCGGGCAATATCTGGCCGTAGGGGTCAATGCCGTAGGTCTCGGGCGACAAGAGGCGCTTGAGCTGGCTCTGGTATC
CTGCGAACTGTCGAATCTGCTTGTCCGAGAGCGGTGGGCCCGAGCCGTCCTgggcctgctgctggcactgctccagctcctgcagcgagcgcttgaGACT
GCGCACTTTGCGGTAGGGCCAGTGGCGGATGCCGATGGCTCGGCACCGCTTCTTGAAGGCCGTGGCGCGCACGCCGAACTTCTCGGCCGCCACCTTGAGC
GGCAGGTGGAAGTGTCGGCTTAGCGCCGTGAAGTTGCACGTGGCCACGggcagcggcgacgcggAGCCGTCCGAGGCCACTGGCGAGTCGCAGGCcgcgc
gcttcttgaagttgtggg