Description :
From Genome Similarity Track
Location :
Scaffold_40:56507- 58168
Transcript NameFunction/comments
Phyta_totarag1913putative glycosyl transferase family 48 protein
Phyta_totarag1914hypothetical protein

Sequence
1661 bases(100 bases per row)
TGCTGTACAACAACGCTTTGAGCCGTGGTGTGGTGATTGAGGATATCCTGCGCGCCAACTCGAGTAATGACGACCGCGATGACGATCTGTCAGTGCAGCA
GATGCGCTCCATCAtcgtcgaacagcagcgatttATCAACGTGCTGACTGCTAGCGGCAGTGAGACCGACATTCGTGCTGCCAGGCCTGGAAAGAAGGAA
GACCTCATGCACGCTATGAGTGATAACACGCTCAACGCGGTGCTGAGGAACATGTCCGAGACGGAGCTGAGTGCGCTGCAGGACTCATCGAGCCGCCTGC
AGGCCATTAtgtcggaggaggagcgcAAGGTCGcgcagcgcaagcagcagcaggaagagcaaaGACTCGCTGAGGCAGGCATGAACCCGTCGCTGTCACG
CACGCGCCGTGCCTTCTCCACGAGTGATTTCTCGGCCATTCCGCCCAACGCGACCCCCTTCAACCTTCCGAGGCAGAGCGACCCAACAGCGCCCACGACT
GCCAGTGGCTCTGCCACTAACGGACATGTGCAAAAGCGTGCGTAGATTTGTTAGACGAACATGCAGGTAGAGCGAGAAAGCCCATTTACGGCCGTTTGCA
TTTTGGATAAAGAGCTACCTTTTGTTCATGTGCGTGTTGGTGCATTTCATTTCAAatgtctacatgtacgctaACGATGGTGGTGAATACGCTTCGGAAC
ACATATTGTACTTCGCTGAAGTAATACTACACAAGAGCCCTGATGGGTCTACTGGGGTCTAGGAATGTCGgcaagatggctacacccTGCATCCAAACCG
TGGTTGCAACACTTGCAATATCGGCACGCGTCTTGGCTTTGAAGGTCTCAAGACGAGCGCGATtgatctgttgctgctaccgGTCACTGATCGGACTGTT
TCCGGGTCCTGGGCTTCTTGCCAAAGCCGCTGAGGAACTTCATGTTGGCActcaacttcttcgtcagcgaGCTTTTCTGGAGTGGGTCGGCGCTGGTCAG
CACAGCCGTCTTGAAGTTCTCCGTAACCTCGGGTGCGCAGTCGCAGACCTCCAACTTCTTCTCAATATCTTCCAGGTTCTTCTCCGAGACCGACCTAATG
ACCTCTAAATCCTCGACCAACTGCGATGAAGACACGTGCGAGTAGATCTTGCGGCTGTCCGAAGCAAAGCATTCGTCAATATCTTGACTTGGCGACATGG
CCAAGTTGGCGAAGAGCTGTTGAATTGCTGGCGAATTTTTCTCAATAAATGGATTAAGAACCCTACACGAAAGCAAGATACAAGACAGGGGAGGTTAGTA
AGCGCTAGAAGCAAAATTGGCCTTTTTGAATGCAACGCATACTTGAATTGGGGCTCTCGGTCTCCAAACTTCACACCAGTCGCTGTCTTGAACAACAGCT
TCGTGACTAGCACAAGTACACGACGCGTCTCAGGTGGAGAAAGCTGTTTCGTAAGTCCGTACAAATGAGGGGTGGTAATGGCCGGGCAAACGAAACGAAG
GAAGAGAAACCCTCCGATCACCGACTATACAAGTGAAAGCAAGCACTATCAAGTTAGATTCGCTGATATCCCGATCACCTAGCTTGGCCACGTACCCGAG
TCAACGTAGATGCGTCCTCCGCCTCAACACCCTCCTTTGAGCCATCAAAACGACTGATAAC