Description :
From Genome Similarity Track
Location :
scaffold_15:56485- 60210
Transcript NameFunction/comments
Pl_112306hypothetical protein PHYSODRAFT_360535

Sequence
3725 bases(100 bases per row)
TCGAGACCGCTGTTCTTGCTGGTGGTAGAAATAGTTGTAGTTGAGCTGGGTCACAACTTCGTTCACGTGAGGAGATGCCCCATGTTTCTGCATGGCTGTC
AACATAACTACCAGGAAATGTGACTGTCGCTTGAACTCTTTTGAGCTTCTTTCCATTTCGGACTTGAGAATGCGAAAGTCAGAATGCTCCAGCACTCGAA
TACTTGGCACCTTGTGATTGCCTTTCTTGATGACTTGATTGGACTCCTCGTCGTTATCTCTCGAATTATCATGAAAATATTTGGTTAAGTTTCGGTCTAC
AGCACTGACGAACTCATCGACTTGCCCAACAAAGCGCAAGATGTGGTTGAAAGTCGTCAGGATGTACTGAACAACAGTCGCATGCTACAAGCAACCAAAA
ATTGGTCAATGGAGAATTTCATAATTAAGAACCAACAACCACAGTGGAATACCTTGTCCAAAAGAAAGAAGCGGCTTAGGAGATGATCCAGATACTGCTC
GTGAATAGCATCCATCTTCGATGATAAGCGATAGTAACGCGTGCAAACAGTGAATTCCAATTCATACGAAGCGATAGCGTGTCAGCAGAAATTAATTCAT
TCCGTACCTCAGCCAAGCTTCTAGACGATTCAAGGATATGGTGAGTTTGGGACCATTCTTCGCTTGCAATCTGTTGCACAATAGATTTGAGGATACAACA
AGGCTAGTTTAACTTGTTACTGATAATACCCGTACCTGACTCGTAAGATAGCTCAGTAAGCTCTTCGTGTAGTGCAGCATGTCTGCAATTTGAATGAGCA
GTTGGCACATGTCCTCCTCGATGCTAAAGGAAAGCATAGTGAGTCCAATCGTACGAATAAGCAAATTACTAGCATGGGCGTACAAAGAATAGCTCCGACG
ATGTCGAAGAGTGGACTTAAACTTCATCAGCAAGAGCAGTAAAACAGATTAATAAAAGAGTAAACACATTGGAGCTTCGTACCTTCACCAGGGCTGACTC
TACAGCCTTCACCTGGACCAGGAACACTCCAAGTCTCGAATATTTCTGCATCACTGATGCGCTGAAAAGCACACGCATTGGCTGTTGTGCAGAATATGTG
AAGTGCAAGCACTTCAGTGTAGCAATATCAATTTTTGCGCCATTCGTCGTGTTGCTATCCAACAGATTGAAGTCGACGCGAACACATAGCCGACCTCCAA
TTTGTCGCTGCAAAGATGACACTGAGTTGTCTTCGAATACTCCTTGAACTGCACTCTGGTGAAATGCGTTAATCATCTCGCTATCAGCCCACGCAACAGG
GTTTTCTAGTAAGTGAGAGACCAGTTTTTCACTAAAAACGTTGAAGACGTCTTGCTGTAGTACGCGAAACATCAAATATGGTCGAATCAGCCTCCATAAC
TTACTGAGTTCAATGTGTTTTTACCTGTTCCATGAGGACGAACATCCTAAGTGCTTCGATGTGTTCCATGTAGTTCATTTTATCTCGAAAGATGTTTGTA
ATCTCACCGTTTAGATCACGGCACTGTATCGCATCATAACGTTGGTTTAATGTTAACGCATCACTGACACATGTTAAAAAGTAATACTTCAAATAAGCAC
AAGCTAAACTACGCACCTTGCTCTCGAGGTGTCTAGTAAGACATCGTTCCAAAATATGGTTGAAAGGTACGCAATCCACCATTATTCGCTGCGAGGAACA
CAAGTCTTCTTCTGTTTCTCGCGATATTGTGGTCAATGAGAAGATACCAGTGTTGTGTCTGTATCCTATCGCGACCAGCTCATTTGTAAACAACTTGTAT
AAAGAAGATGGAGGTTGTTCACGTTTCACCACTGTTTCTTCGGAAGTATATTGCTGATGCTGCAAAAATCGATTCATTATCTGTTGGCTGACCAATGCCT
CATGCATCAATTCAATTACCGATTCAAGGAATGTAGGAACAAGAGACTTATTGACTTCGAACGGAGCAAGAGATAGCAGCCCTTCTCGAAAACTCGGATT
CCGTTCACGAATCGGAGATGCACCAACGCTCACTGATGCTGGTGTCGCGAAAAATAATTCTCCATCCAGACGAATCGTCTCAAAATGTCCCCTTTCAAAA
ATCATTCCATTCAAAAGGTCCAAGTACGGGTTTAACGCCCCAATAAACAGATGCATCAGCACATCGGATCGTGATAAACTGCCTGTAGTTTTCGCATGTC
CATCAATATAGTCTGCTTTCATTTTGTGATATAGTGAATCAAGCACGCATTTCGCTTGCTCAGCACGCTTAACTTCATGCCAATGTCGGTCCGATAAACT
CTGAAAGCATTTCACCAAGACATCTTTCAACCACGAAATCATCTCGAAAATTTCCATTAGGCCACCATAAATTCCAAGTAGGGTAGGCTGTCGGGAATTA
ACTCCAGACCACGGACTAGCGTCATCATCTTGTAATTCTGTTGAAGCAATAGCCTGCTCCTCTACATTTCGGATTGAGTTATTCAAACTGTTTATAACTT
GCGATAGAGAATTTGCCAGACCCTCCAGGGTCACACATCGGTGCTGCTCACTTAAGTTCCGTACTTGGCGAATAAACTGGAGGAGATCTCGAAGCACCTG
TAACTCTGATGCTGCTTGCGTAAAATAACCCAGGAAATTCTGTAATGCCAAACGTGAGAGATGCCCAATTACCACACTTCGTGATCGTCGAGATTGTTCA
ACTACCTTCGTCTGGAAATCTAAACTGAAGATCGAGGGCGTAGGTCTAACCGGGTGAAACTCAAACAAAAGGGAATCGACCCCGTCCAGTGCCTCGAAAA
CCATACTAACCACAGTTTCTTCGTGCACAAGTCTACAAGGTACAGCAGTATTCGGGTCCGACGTCTTAACCACCGCTTCACACAACAACCATGGTCGATC
TAAAGTAAACGGCACAAGCGTTTTCATTTCCAACACACACGTCGGATCCTCCACATCTTCAATCTCCACGTCTCGCACAAAAACTTCAGGATTATATCGA
CATAATATTTCATCCTGTGCCAGCGCCTCGTCCGACAACTCTGTTCGTTTCCTTCTCTCTATCACTTGTCGACGTGCAATTTGCTCTGTACTCTCAGTCG
CATCCGACGGCATCGGTATCTCTTGAATATCACCCTCCAACACTTCACTTGGTCTTTTGGCATTGCGTTGACGAGTATCAACACTGGGTTCACTCTCTAC
TGCACTTTCATCTGCGCTTATGTCCCAGTCACTCTCATCCTCGTCACTCTCATCCCAAGCCTGGTACCACTCGTCATTTGTAGAAATCTGGAACAACTCT
TCAACTAACTGGTCCTGCATTTTTTCGAGTTGCTGCTGCTTGAGTTTCTCCTGTTGTAGCACTGTTTTCCATCTACTATTGGCGTCCACATCCACCGCCA
CATCTTCATCGGTGGCAGTCGTTGGGGACGTCGCCAGCTCCAGTAGAAGCTTTAGCACTTGATAGTCACAGTGTGGAGCCAATTGCAACAGCTTCTCAGC
TCGATCTTCGAGCGAATGGACGCGGAATTTGGTCGCAAGCGCCTGAGTTTGAGCATTCACATCTTGAGGTAGGGAATCTGCGAATCGATGCGAATAGAGC
TGCCCTACGACGCGGTCGGCACGCAGCAACAGCTTCTCATTGGAGAGTGAAGACCCCGCTTCATCATGAGACCGATTAATGTCGCTAATATGCGCGCAGA
GCTTCTTGACGAGAGGCCGCCACTC