Description :
From Genome Similarity Track
Location :
Scaffold_1143:5648- 7692
Sequence
2044 bases(100 bases per row)
CAACTCTCAAGATCCCGCACAGGAGGCGGAAAGTACGACGCAAAGGAACTACTAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACG
ATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCCTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCC
ACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAG
TTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCC
GCTACACCACAATGACGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTTACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGA
GGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTG
GATCCGGATCCGGATCGAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACTTGCGTCAAGATCCGCTAGCAAAAC
AAGGAGAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAA
GACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAG
TTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGACGATCCAAGGGAACCGGTAA
GAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGA
TATCTTCGAGCTAGATCTGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCA
GTGTCATCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAAACACGTCGTCCGAACCACGACGCATGACTTTAG
GACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGGTCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCAGTAGGCCCTACGCGTGA
TCTGACACAATCCATCCAGGATCAAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGACCCTGTCTCG
CCAGTGAACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTA
TGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAAATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGA
CCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCA
GCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAG
CGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCC
AGATTGCTGCGCAGCTTCCAGACCCAGTACTGTGGATTGGGAGT