Description :
From Genome Similarity Track
Location :
Scaffold_25:56470- 58197
Transcript NameFunction/comments
Aphas_H257_09608Hypothetical protein

Sequence
1727 bases(100 bases per row)
TGGGACGCCCGCCCCGTCAAGTACACCAACGTCATCATCCAAGTGTGCGGGTTCATCTTGCTGATGGAGCTGTCCGAACGTCTCAGTTACTATGGGATCA
ACCAAGGATTAAAGAATTTCATGGGGAAGAAATTGAATTGGTCCAGCGTCTCGTCCAACAGTATCAAGAGCACGTGGACGTCGCTCGTGTACATGTCTCC
GTTGCTTGGTGCGTACATGGCCGACGAACGTTGGGGCCGCTTCAAGACGATTGCTGTGTTCGGCACGGTATACATGATCGGTGATATACTGCTTGCGATT
GCTGCGCATCCCAGCGTTTTGTCGCTTGACGGCAGCACCAAGACGGCGCAAGCCATCTTCATCGTGGGGTTATTTGTGTTTATTGGGATTGGTACGGGCG
CGATCAAGTCGAACGTGATTACCCTCGGCGCCGATCAGTTCAACCCCGACGATGAACGTGAAAACGCCCAGAAGGTCACGTTCTTCAGCTATTTCTACTG
GAGCATCAACGTCGGGGCTGGGTTTGCGTACGGATACCTGGCCACGTTGTGCGTCAAGGGGTCGGGTGACTTCATCCCCAAGGAATACGGATACTTTGCC
ACGTTCACCATCTGCGCGTGCGTGTTCATCTTAGCGCTGGCGTTTTTCTTCCTCGGCAGTTCCCGGTATATCAAGATTGCCCCCAGCTCGAATGCCATGT
CCAAGCTCGTCCATGTGCTGCTCGCCAGTTCGTCCAAGAGTACCGCTGCCCGGTACACTGTGTTCGGCTTCATCGCGTTCATCTTGTCGTTCTTCTTGAA
CTTGCTCGCTGTGTTCTTGACGGACAGAAGTGACGAGCGCCTCGCCATGAGTTATGTGGCCGGCGGGGTGTCGCTGATCGGGGTGTTGATGTGGGTGTGG
TTTGGTCGCCAATACGACAACATGAGCCTCGCTAAGGAGTCCGAAGGCGGCAACCAGGACGACTTGTCCATCGACGAGATCAAGCTCGTGGTGCGCGTGC
TCCCGTTCGCTGCGTTCAACGTCATGTGGCAGTGCGTGTACGATCAAATTGACGCCAACTTCCAGACCATCGCGCAGCAAACCGACTTGCGCTTCGGCAA
CGAACGCGATGCCACGCAACTGCCCGGCGCCGTGCTCGGGGTGTTCGACCCCATCGCCATCGTGGTGCTCATTCCGTTCCTCGAGACGGTCGTCTACCCC
GTCTACAAGAAGTTCTCCGGCAAGGAAGCGTCCGCGTTCGGCAAAGTCGCGGCGGGGTTGATCCTGTCCACGTTCACCATGTTCTACTCGGGTGGGTTTG
AAACCGTCCGCCGCAACTCCGGCGTCCTCCTCGTTCCCGCGAGCGCCACCAACAGCACCCTCGACGTGATCCTCGACGCGAGCTCCGATCTTCCCATGAA
CGACATCGCATGGGGCTGGTGCATCCCCATGTACGTGTTAGTCGCGCTCTGCGAATGCCTCATCAACGTGACTGCATTCGACGTGTTCTACACTGAAGTG
CCGTCGTACCTCAAGAGTACCTGCCAAGCGATCAACTTGTTTATGGTGTCCATGGGGTCCAACGTCACGAGTATCTTCACGCTAGTGTTCCAAAAGTACA
TCCCCGACGACTTGAACGACGGCGGCAACTTGGAGTACATGTTCTACGGCGTCGGCATCGTGTCGCTTGTCAACTTGATCGCATACCTGGTCGTGATGAA
GCAAATGCAGTTCGGCATGGCCTCGTC