Description :
From Genome Similarity Track
Location :
Scaffold_123:56464- 57618
Transcript NameFunction/comments
Phyke_g5893myosin-like protein

Sequence
1154 bases(100 bases per row)
AATGAACGCAGTCAGTCGATCCTAATTAGTGGTGAGAGCGGAGCTGGAAAGACGGAAGCTACCAAGATCATGATGACGTACTTCGCACTCACGTGTGGCA
CTGGGAACCGTGTAGATGAGATGAAAGAGGTAAATGCATCGGATTCTCCGCGCACGACTATTGAAGatcaagtgctgcagtcgaaCCCTATATTGGAAGC
TTTTGGTAATGCACGCACGGTGCGTAATGACAACAGTTCACGATTCGGTAAGTTTATTGAGCTGCGTTTCCGTGACCAACGGAGGAAATTGGCGGGTGCA
CGCATCCGCACTTacctgctggagaagatTCGAGTCATCAAGCAGGCGCCTCACGAACGCAACTTCCACATTTTCTACGAGTTATTGAGTGCCGGTACTG
ACTGTGTGAGTAAGGAGCAGCGTCAAGCATTGGCGCTGGGTGGAGGTGCTAAAAGCTTCCGCCTGCTGAACCAAAGTTTGTGTTCTAAACGTCGTGACGG
CGTGAAGGATGCCGAGCAGTTCCGTGCCACGCGGAGAGCCATGCATCAACTTGGAATGAGTGAGCGCGAGATCGCGGGGGTATTGGAGATTGTGGCGGCT
GTATTGCACATGGGTAATGTAGATTTTGAGCAGATACCCCACACGCGGGGAGATAACGTGTTCGCTGATGAGGCTCGTGTCGTGTCCGAACCAACTGGGG
TCTGCGATCACTTCAAGACGGCGGCCGAGCTTTTGGGTGTCACCACAGAGGCACTGGGCCAGGCACTCACTAAGCGCCGACTACACGCTTCCAACGAAAC
TCTTGTCGTTGGTGTGGATGTCGTCCACGCACGTAACACGCGCAATGCACTAACCATGGAGTGCTACAGACTACTTTTTGAATGGTTGGTGGGTCGTGTA
AACAGCAAGCTCCAACGGCAAGCTGACACGCCGTGGGATACAGATCAGGATTTCCAGAACGATGACGAGTCCGAAGCAAAGGATTTTATCGGATTGCTGG
ATATCTTTGGGTTTGAAGACATGGCAGAGAACTCTttcgagcagctctgcaTCAACTATGCTAACGAGGCATTGCAGCATCAATTCAACCAGTATATTTT
TGAAGAGGAACAGCGGCTGTACCGGGATGAAGGTATCCGCTGGAGCTTTGTGGA