Description :
From Genome Similarity Track
Location :
Scaffold_112:56462- 58828
Sequence
2366 bases(100 bases per row)
GCGGGCGACTTCACGTGCCTGGATGAACTGTAAGAGTGCATCATCCAGTTGCTTCTGCTTGTAGAATTCCATGCCTGCGTTCAAGAATTCCAAGGCGCTT
GTTTTACCTCTGATTCTGTGTCAGCTTGGTTGGAGGGTAGATCTGATGGGAGTGAGTGCGGTGGTGAAGGTGGGGACGAGTGAGGCGCTGCATTGATCGG
TCTATCATCCATtGTGGTCTCGAAGTTACCGTAAAGATTTGTTGGCAAAGACTTTGGTGGGTGAGGAGGAGGAGGGCCGAGAGCAAAGAAaTCTAATGGT
GGAGTTTGAGAGCCATACGGCGTTGGTCGTGGTTGAGTCACTGGTGACGTGGAGAACGAGCCGTATGTGTCATCCGTGATAGCGGTAGCTTTCTTGGGTG
GTACAGTAGAGTTTAGCGATAGCCCCGCCGTCAATGTGACGAAACTCCCGTAATCACAATCTCTATCTTGGTTCGAAATTGGCTTTGTCGATGGCTGGTG
GGGCTCAGATAATTGAGAACTCGAACGATCGAACTGGTCGAAGGTGCCATAGGCGCTATCTTCATACGGAGGTGGCGGAATGGGGCCAGTTGGTCGCGTC
CCCACCACCTGCTTCGacGGCTGCACGATGGAATCGAAACTTGCATACTCATCACTGAATGgAAttctCGTCGACCCATCATTGGAGTGTGCAGGTgaCT
TCACTACGCGGTTGAAGCTAGTGACTGCCGAAGTAAATGCAGTGAAGTCTGTGTAGTCGGCGCCAGCCGGTGGTGTGATGAATGGAATAGTCGAACGGCG
CGATGAACGTGAGGGAGACCCAGGTGGTGTTCGCTCAAATGAGACCGCAGTCgCGGAGAATGCGGCATAGTCATCCATGGCCAACAACGAGGTGCTGTTG
TTCGACGATGGGAGTGTAGACGACGTAACGGGAGCCTTCAGTGTGAAACCAGGAAGTTCCAATGGCGCATTTAATGAGAACTCGGCGTAGTCACTGTCAT
CCTGTGCAGCTTTGTgcACTGCACCAGCTCCATTCGCTCGAGCTGTGTTGATACTGAGAAGGAAGCGTGGTGAAACCTCTGGGGAGCGTGCAAAGaGTAA
ATTtGGATGCATTTTCTGGGGGCGATGGgCTGGGGAAGAAGTAGATGACGAAGGATCGAGAGAGTCTGTAGAGAATGCCGTATACGAGTTGCTGGCGAGA
TCTTGACGCACACGCACAGCTGCGAGCTCAAGGTTACAGCGACGCGCAAAAGCAGAAGCGACCTGGAAGACAACTGATTAGAACCACCAGCAAATATCGT
TGATAGCTGAAAtcTCCAACATACTCCGTGCTTCAGGCGGGAGgCACTGCGCTGGATGAAGGCgCGGATCGAAGGATACGCTTTGTTTCGAGAATCCGTG
AGGACATACCCATTCTTATCACCGCACACAGTCTTTCAGTCTCAATCAAATCGTTAAGATTGTATGCCATCTTACCTGTCCGATGCTCTCGATGAGCACG
TTCCGCATTTCCcGACGCCCAACGCGAGGGCCTGATGAATGTACCTTAATGTACGACAGACAGAAGCGTGTAGGCTGCGATTCGCTAAaGCGCACTAGAA
ATGCACCATCTTCGAGATCTGGCGCCTTGAGGAGTACATTCTCTGCCTCAGCGCGTGTGATGGTGCCGTGGAACCAGGTCACGAGCTCACGGTGCATGGT
AAGTGACTCCACCATGCGTTGGAGACTCGACTCGATTGGGCCGAATCGCGCCAAGAAATGAAGGAACTATGCATTCTCGTGAGCGAACGGCATGGTTGAC
GCACACCAGCAGATTGAGCACATACCTCAGTGAGCGACACTGTGTCATGTTGCCAGGCTGAGTCGGCGATGCAGTACTTGGCGACGACGCGTAGTTCATC
GAGTGAGAGTGCATCACTTGTGGGCATCTCCAGCCGACTCGACTTGAGCAACAaCGGCAAGAACGACATGGAGAAGTTGACACGGTCATCGCGCACGTCT
GCAAAGCGCTCATTCCACCAGGCGACGGCCTCTGCATGCAGCTCCGGCGCCATACTCGTGCCCATGATGATACACAGTGAGCGTAAATagAGCTCTtCGT
GTTCGACAGTCTCTGCCACGGATTTCAACCAATCAACTCATGCCTCTGGAACGCAATATGACAGAATCAGATCATATTCGGAAGGTTTCTCGACACCAGG
TGAAATGGCTTCAATTGTCATGGTGATGCGGCCCTGCGTAGAGATGTGGGTGGCGAGTGGGAGCTCAAGCGAGCACTTGAGCCAGCCAGACCCAAGTCGC
CACGGAACCTCTCCTGGTTCATGGGGACTCGTGTCGAGCTGCTCGGCCAGCGAGTGATCTTCGCGA