Description :
From Genome Similarity Track
Location :
Scaffold_176:56438- 58608
Transcript NameFunction/comments
g10677.t1hypothetical protein
g10678.t1hypothetical protein

Sequence
2170 bases(100 bases per row)
TGCGGCCGCCACGGGCGTAGCGCCGGCCTTGCTCGTATCCTCTGCGTGGTAGCTCTCGAGCGTTGGCAGGCTGCAGCGGTCCTCGTCGAACTGCTCGCGG
AAGCTGGGTTGCTTGGCCAATCGGATGCTCAGGCCGGCGCTCGTAGTCTTGCGGCTACGGCGTAGCCACTCGGCACCTGGAGCCGACTGCACGGAGGCGA
AGGAATGATGCGACACGAGACTGGAGCGCGCGCTCTCGCCGCCGTCCGTGTCGGTTGACGGCCGCCGCCGCCTCGAAACCGCTTGCACACGCGAGCGCAG
CTCCTGTTCACGCTGCGCCGCCGCTAACGCATTGTCCACCTCCCGCTCGAGCTGCTCGGCGGCCGACACGTCGCCTCGGTCGGACATTACAGAAATGCGC
GCCTGAGAACGTCTCGCAACGATTTATACGAGCGCTTCCTGGGTGTTGGCGTCGCCAACTTGGCGGATTGTGGTCTGCTTTGGCTTTGGTCGGAAAAGAA
TGGCGGTTCGGGATTGGCTGCCGAACGTTTTGGCCAATAAATGGGCGGGGCGAATAGTCAGTGCTCGAAGAGCAACAGCGCGATCGATGGCAGAATCAAG
CATCTGCTGCGCCCTGAGTTGTGCAGGTTGCTGTTGTGGCGACTTTGACCTCGCTGTCATGATGACAATGAAAGTTCGTGCAGCACAGTTGATGGATTGA
CTGCGAAGAAAAGTCCGCGCGCTTTTCCGCGAGGCTTTCCTGCTTCGTAACGACACCTTCGTTTCAAATCAGTACCCGTCCGCGATCAATGGCCTTCAAG
CCTCGAATCAAAATTGTTGGCCGCGGTGCTGGCGTGGCGGGAGCTGATTGGAATTGAATTGCCCAGTCTTTGGTGACTACGGCAAGGAAATGGCGGCGAA
GATTACTCCACTGCGGCCCCAGTAATCTGCAGCTGGTCTGTAGCCATGTCCACATCGGTATCCGAGCGCAGGATACCGCGGGAATATCCACGGCCGATTG
CTCAGCGTCACCACACGTGAGACTTTCGTGTCCATTGCGTCAATGCGGTGCAGGACAGCTCTTGAAGCTGCCATCATGGGCCTCGAGTATCCAAGGCGAT
GGATGCGGTTTTGGAAATTACAGCGTGCTCTAAATCGGTGTGGCGCACACATCGTGCAAACGCCTACTGAAAGTTTCCGCTATGGCGCTGCAGATCCATC
GCTCGCGGGAGTGCGAGCTCACGCGCGTGTGGGAGGCCAACACGTCCAGCTTCGAGAACTTGCAACAGCAGGTGCAATGGGGAAAGGTGGACGCTTCCGT
CGTCACCGTCTCGAACGGGGTCATTGAATTGCACACGGACGCTTCAGAGGACACAAAGCTGGAGTTTTCAGTCGCCGTGGGAGGGAACCGCACGCTACAC
CGACTCTTATTCAGGACACAGCTACCGCAGGTGGACACTTTTGTCCTCCAATGGCCATTTCGGGACTATATCTAGACAATTGACGTGTTTTGCGATGACA
CATTTTGCAGAATGGACAAGCGACGTTGAAGGTGGTGCAAAGTGGCCTCACGATGGTCTATGGCTCTCCGCCTGCAGACGCAGCGAGCAACGAGGTCTTT
GTGGGCTCGTCGCAGAACACGTCGGTCGCTGCGGAGCTGCCGTGTGCCTCGGTACGTCTGTTGCAGTGGGTGAGGAGAGACGGCGGGATACCTAAATATT
GTGTTTTTGTTGTTGTAGGATGCGACCGACACTTTCCACGATGTGAGATTTGAGTGGGACGACAAGTGGCTGCGCTGGTATGTGGATGAGGTGCTGCTGC
TGGAGGAGTTTATCCAAGGTGCTGGTTTAGAGAAGAGTGAGGGAGACAGCCAAGTCGTTGTGGAGTTGAGTGTGGGGGCGAGTGGTGGTGATGCCAAGCT
GGCTGTGGAAAGGATTGTGTTGGGCTCGGGCGATTCGGCGGATCCATTGTGTGCTCCCCGGTATTCGAGCTCCAGCAACTGTCGACCCCAGGAGTGTACG
TTCGTGGCCTGCTACTGTTTTAATTATTGTCGATTGTAACCTCGATGATGTTGTTGCTTGCTTGTCAGCATTTGCACCGCGGCTGGGCTCCATCCAGGGA
TCACTGACGGTCGATGAAGTGGAGGCATACATCGATGAAGTAACCTCGGCATTTCCTCTCATCTCGAAGG