Description :
From Genome Similarity Track
Location :
Scaffold_22:5641- 7009
Sequence
1368 bases(100 bases per row)
TGACCCCCTTTTAAACTCTTATGGTAGTGGTGGAGCAAGTTAGTCTGGAGACTTTCCGGTACCACCAGTCTGACCGTCATGTCGCGGCCTTCTCCCTCGA
CTATAGAGTTGGACAATACACCAACAATCCTTACTCGCTGATATCGTAATCTTCGTACATTTTGCTACACTTTTTAGCGGATTCTACCGACAGGTCTCTT
CAGTCCGCCTTCAAATATGCATTCGAATCTCCTACCCAGCTCTCCTCTTCTTGCGCCTTTCGAATTCGTTGCATGGTCCCTCCAGATATCTCAATAGGAG
ATCGCGACTGAATTACCACAAATATTTTAGTATAGAGACTCTGGTCTTTAGGAGCTAGCAGCTCATCAGACGATTGATCACGTCCAATCCTGGTCTTTCT
TCACTCGGCATAGACTTGATCTCCCCTTTCTGGTACAAGGCTGTACTAGCCAACTGATTTGCGCTTCCTGGTTCCAGTCTCGTTTCACATGCTGGATCCC
GTGAGAAGTCCACGATTGGAGTTCATTTGAAGCCCGGTCTCGCAGTGATGATAGACCCTAGGCCTTACACTTAATCTCCCGTCGCATATGCCGTACCACT
AATTTGGAGTCTCCACAGATAATCAACCGCCGCCGCTCCAAAGTTTTCAATAAGCTAAATCCAAGCAACATACTATCATATTCTGCCTTATTTACCGTAG
ATGTATCGACATATTTGGAGGCGGCTTCGACTATGGTCCAAGCTGAGAGTCTCCATACGATAGCGCTAAAAGCCCCGCCTCCTTGCTTAACACGGGCCAA
CCCATCAAAACGCATTACATATAGTTCTTCTTCCGGTTCTACGGTTGGGGTGGGTAGGTTGATCGTCTGCCATGCCTGATTCTTAGGGGCAATGGCCGAC
AATATTGAGTCTGCACTCTATCGAAGGGTAATACTAGCTTTCAATGCCCCCAACACCTGGTCTTCACCTTTTTACACTTCACGATCTCCAAGGTCCACTG
AGCCTAGAGAGCGTCCCAGTTTCCCAAACGCCCCTGCAAGCCGGCAGATTTCACTAACTACGTCAATGTCGAGTATCACGTCAAGACTTTTAGGGGCTGA
GTGACCAACATGGTGAAGCAAGTTTCCAGTATACGTAATAAGACTAACACTTCTTCCTCTACACTACTGTAATATAATTCGTTAGCCTTGAGAGTTATGC
TTGTAAAAGCCGGCATAAGCAGTTCTTCATAATACTTTACCAGTGACGCCGAAATGGCCCATTCACTTGCATAGACAATAATCATGGCTTCTCTGGTCGG
GTTGAAGTTTCTCAGAATTGGCGCCGTGGCAATTTTATTCTTAAGCATGGCGAAGGCCACTTGGACAC