Description :
From Genome Similarity Track
Location :
Scaffold_158:56374- 59082
Sequence
2708 bases(100 bases per row)
GGCAGGGCCAGGACAGGGGCCGCTTGGAGACTGGCCTTAATGCTGTCAAAGGCATCGTGGTGCTCTTGCTTCCAGCGCCAGTCGGCGTCCTCCTGAAGGA
GACCCGACAAGGGCTTAGCAAGGTCCGCGTACCCTGCGCTGTACTTGTGTAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGAGATCGGGG
CGTTGACCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCATGCTGCTTACGAAGCAACCGAGACCCTTGATCTCTGGTGACGCAAAG
ACGCACTTGTCGATATTGGCGTAGGGCTTGTTCGCTCTCATCACGTCCAATACTCGACGGAGGTGCCCCAAATGCACCTCTATGGCCATCGTTGCTCCCT
CGGCACGGCTATGGACGAAGACGTCGTCGAAGTACGTTTGTACGGAGGCGCGCAATGACCAGAACCAGGCGGTTGAATGTCACCGAGGCGTTAGACAAGC
CCTGCGGCATGACGAGCCACTCCCAAATCATGCCGCTTAGAGTACTCACCGCGGTGAGCGGGATGTCGCTCTCGCGCATCAGGATCTGGTAGTATCCGTC
TACCAAATCCAGCGCACTGAACAATACACTTCGGTCCATGTTGTTTAGCAACACATCCTTTCGTGGGATTGGTGTCTGGGCCGGCACCGTCGCTTTGTTC
AGCTTGTTATAAGCATGAACTAGACGCCACTTCCCGTTCGGCTTCCGAACGCAGAAAGTTGGCGTCGAGCGCGGGGACTTCGACTCCTGCACCATGCCTG
CCTTCGCTTTCGCAGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGTGGAAGAGGCCATTGTCTCGTGACACAGTACTTTGTACCAGGCACAAGATC
GATCTCATGCCGTACGACTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTGCTCACCACGTCCGCATACTCCGCCACCAAAGGATACACCGGATCCTTG
GGGCTCTTAAGGATCTCAGAATCCAAATGCGTCTGACACTGCTTGCTCAGCTCTTCCAAGGCGTCCTCGTCCAAGACAGAGGAGGAGTTCAACTCCTCCC
GAGTGGTTTCAGGTCTTATGAGCACCATCTCGGCAACCTTCCCAGCCTTGCGGTTGGCCAGGAAAGACTCAACCGTCATTTCCTCGAGGTTCAGTATCTC
TGCAACCTCTGGCAACGATTCCATGTGAACATCAAATGCCTTGACGGGTAAATCGGTCTCGCCATCGAAGATGTGATAGCACTCTTTCACCGACCGCGTC
GGAGGTGCCCGGGCCCTGGGCTCCGAGTCGCCTGAAGTGACGTCGATCTGAACGAAGCTCAGATCCGACTTATGGCGATGGCGGCGTCGTCGTCGATGGT
GACCGTGACGCGGAACTTCGTTATCCACGTCTGAGGATGTCGTGGTGTCGCCATCCGGGCACTCTAAGCCTCGTGTGGTACGGTGTTACCCACACAGGAA
GCGTATCCGACGTCTTCCTCTATAGTTAAGGTCTGGGCGACCGTGTGTGGAACTGTGCTACCCACTTTGAGCACGCTAATATCAGCGCTCGTGACAGCTG
CAGCAGTCTGCGGAACTAAGTTATTCGCTTGTGGACCTAGGTTACCCACTTGGCCAGCGCCTCTTCTGGGCGCTGCCACCATCAAAACATCCCCGGAGTC
GTCATATACGTCGACGATTCCCAAGCATCTGCCGGATGCTTTGGTACTCTGGCAACCCTTGCGGGCGCCCCGGGTCCTGGCAGAGGTGGGAACATGACTC
ACCAATGCGCAGGCCGGCTGGCACCGAATGCCTTGGCTCGCCAGTCGATCCGGGGCTCGTGCTTCTCGAGCCAGGGCATGCCCAGGATCAAATCGTAGGA
ATCCATGTCGAGAACAGTAACCTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCG
GCCAGTCGCACTGACACCGTCCCGCTGCCCTTTGCTTTCTCTCAAAGCATCGTACAACTTGTTGCTATTACGAGCAACCGTCTGGCGGCGTGCAAAATTC
TTCGACGCCCCAGAATCGATCAAGATTCTACCGGGGTGATCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGA
GAGTGCGAAGACTCTCAGAGGCTAAGTCCCCGTGGTACGCGCCACCCGCTCACCCCTCACGAAGACTTAGCTCTTCCCCAGTAGGGCTCCCCGCCCCTAC
TGGTCTCCGACGTTCCCCTGTACCCGGGGTCCTGGCTTCTGTCAGCGACCTTGAGAACAGACTTGGGGAACGTCCGCCTGCGGTGTCTCTCCGCGGGGCA
GTCCCGCTTGAAGTGGCGCAGCTTCCCGCAGCCGAAGCAGCGAATGTCGCGCTGCTCGGCGGACCTGAGCTCCATGGGAGCTGGTCCGTTGGAGTTTGCT
CGACCGGGATTCGACAAAGAATGCCCAGGCCATGCTGAGGCCGCGTTCGCGCGTGGCGATGACTGTATTCTATCTGAAGAGCCACTTGAATCGTTTCTTC
GAGGGTGCTTGGCTGCACCCGGAACAGCTGATTGCGCGCTGGGCCTACTCGAAGGCCATCCATGAGTACAGTTATCTTGACGTGCTCGTTGAGTGGGTTT
CCCACTAG