Description :
From Genome Similarity Track
Location :
Scaffold_54:56373- 58514
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09804Hypothetical protein
Sappa_CBS223.65SPRG_09805unnamed protein product

Sequence
2141 bases(100 bases per row)
CTTTGAGTTTGGCTGCAAGGAGCCACTGGCACTGAGTGCGCTCTTGCATGCACCGTTTCCGACAGCGCGGCTGGCGCCGTATGTAGCGACCGTCGGGCGC
CACGTGCACTTGTACGCGACTCTCTCGAGCGTCGCGCTGATGCCGCTGGAGATTCTCTCGATTGACGCGTCGATGACCGATGACGTGGCCGTCGAGAGTC
TTGTCGGTGCCGTCTCGGATGGCTTTGCACTGAGTGACGGCGACCAGCACAGCCTCGTGGTACGGCTCGTGCCCCGCGCGATGCTGGCGCAAACGAGCGT
GGGGTGCGTCATCGTACACTGGCGCCGGCCCCACGGTGACGTGGTCGCGTCGACGCTGCCATTGCCGCCAATGACGTTTGTTGTGTCGCCCGTCAGCGTC
GACGTCGATGTCCCTGCGTTTGGCCGCGAAGGGCACTTGGCACCGCTGCGCTTGCATACAACCAACCACACGCATGGCGTGCTCAAGGTCCAAGTCAAGC
TCTCGAACGACTCGGATTTCCTCGTTTCAGGTACGAAAAAGTTGCATCGGTAGGGAGGATGAACACTATGGCTAGGCGTCACCGAGTGCACGGAGGAGGT
CTTGCCGGGCGAGGTGCTCACATCCACGTTTGGCTTGATTCCGATGCAGTCGGGTATGGATGCGCGCCCACGGTCTTATTGCTGAGAATCCTGCTAGGGC
ATCTCAAGTTGCCCAAGATGGAAGTGCTGCACGTCGACGCCAACGAGTGGATCGTGTCGGTGGACGAGCGCACCGAGCTCTACGTGGTGCCAGCCAACTA
CACTGCTGAGATTGCAGCCTAGTACGCCAAGTATCTCGCCGTAATTATAAACGCGCTCGTCTGTGTTCTTGTGGACGCCGTGTTGCAGACTGCAAGGTAC
CATTAGTAGATGAGTGCACAAGCCATGCTTCCTGATCTGGGAAAGGTCCGAGAGTGTGCCACGTCACGTCGCTAAACGCACGCAACGATCCGGTTGTGGA
GTTGTGGAATGAGCAATAGATAACGCTTGCTTTCTATCATATCTGGGTTTGCCGTTTGGCGAGCGAGATGATGCGGCCAACGTACGACGCTGGCATGCTC
CTCGCCGCGAGCCTCATGGCGTGCACCGCCATCGTGTAGGAGCTCGCCATCAGTAGGTGGACCAGCGGTGCTCTGGCGCGGGTGGCTGCGCAAGCTCGGG
CGCTTCAGGTACGCAGCACACCGTGGCACCTTGGCTCGAGGCAGGCGGTAGCAAACGCTGGCAGCGCCGGTACTTTGTGTTTGTAAAAGGCACGGACGCC
AAGGAGCTGCGCTACTACGGTACCTCTATCGCTATGCAATCTACGCACTCATTGCATGATTCCTCATAGACTCGACCACGGCGACGCACCCGGAAGGTGT
CATGTCCCTCGCCGACGCGACGGGCGTTTGCTACTTGGACACGGTGCAGGTTTGTCGTCGTCGCTTGATGCAGATTGTCTCCAATTGCACTCGGCAGGCA
CGGTCGCCGTCGCCTGGCGAAGCTGCGTCGTCCGACCATAAGTTTGCCATCTTGACGGCCGAGGTAGGACGTAACGACGATGCTGCACGCCTACGTCTGC
GCTAGAACGTCTGGCTCTTGGGCTTCAACGATGCCGAGTCGGCGCAAGAGGACGGTTTGGCACTTCTCGGCGCGCTCTCGGCCTTCTATCCGCTTGTCGA
CGTGCTGCACGCTGGGTATCTCTCCAAGCGGCGTGAGCGTACGGTCCAGAGGTACTTTGCTACTATCCAATATCGATATATGGATAGAGGTGGATACTTT
ATGTTGCCTATCCATGCTAGTCCCAAGAGTATCATCGCCTACTGGAAGCGGCACTTTTTCGTCTACTTGGCGTCCGGGGACCTGCTCTACTTTAACGACG
ACAGTCTCTCGACGCTCCAAGGCACATTGATACATTGATACATTGTGCACAGAATGGACATGGGGTTCTAGGACGCGTCGACGTCAAGCATGCGCCGACC
GTGCGCGTCACGGGCGAGCAGCAGTCGCTTCTTCGCGCCAAGAAAGAAACCGGCTTTTTCAAACTCTCCAAGATGCGCGCGTTGGAACACGGCAGCTGCC
TCATTTGGATTGCCACGCCGCCGTCCAAAATGTACACGTTT