Description :
From Genome Similarity Track
Location :
Scaffold_70:56352- 57424
Transcript NameFunction/comments
Phyci_29764Hypothetical protein

Sequence
1072 bases(100 bases per row)
TGGCGCTGGCGCTGTGCGCGACCACGCTGGCCGCCTCCGAGGTGTCGGCGCTGCGCCCTCACCCGCGGCGCGCGCTGTCGGGCATCCACCACACGACCAA
GTACGCGCCCAAGGTGGTGCAGCAGCACAAGGGCGCGCCGCCGCCGGTCGAGCAGGACAGCGGCTCGTCCGAGTCCTACGACTCGTACGACTCGTACGAC
CTGGACGGCTCGGACTCGGCTGACGTGACGCTGCAGGGATCGGAGGAGCTGGACGTCTACAGCTCGCAGGACCTGGACCTGGACTACAGCGGCGACGCCG
ACCTGGACCTGGACCTGAGCGGCGACGGCGACCTGGACTACAGCGGCGACGGTGACCAGGACCTGGACCTGAGCTCCTCGGGCGACATGTACTTCTCGGC
CGACGCCAGCCTGGACTCCAGCGACGAGCTGGACGCGGAGATCCAGTTCCAGGGCTCCGTGGACGTGGAGCTGGACGACTCGGAGGACTACAGCCAGGAG
CTCGAGTTCGAGGACGACGAGGTCGTGGACGAGATCATCGACGTGCCCGAGGGCGCCAAGTCCATCCACCTGCGCGTGCACCGCGGCAACGTGGACGTGG
ACATCATCAAGGGCGCCAAGAAGCACGCCAAGAAGGAGACGCAGCCCGAGCAGAAGAAGGAGGAACCCGCGGCCCAGCCCGAGCAGAAGAAGGAGGAGGA
GGCCGCCGCCACCGAGACCAAGGAGGAGAGCGTGTCCTTCGCCGCCGAGGCCAAGGAGTGGCTCGAAGACAACCGCCACAACGGCGCGCTCATCGGCAGC
GCCGTCGGCGCCCTCGTGGGTATCGTGGCTGTGGCCGGCGTGGCCATCGCCAAGAGCCGCAAGCGCGCGTCCGAAAAGTCGGTGCTGGCGGAGGACGGCG
CTGCCGACGCGGAGGCCGAGGCTGAGGTGGACGAGGACGCCGAGTCGGACAGCGACGAGGACAGCGACGAGGACGTGGAGGCCGGCGTGACGGCACTCAC
GGAGGAGGACGCCGTCGCCGAGGAGGAGGAGGAGAAGAAGTCGAGCGTCGTGGAAGGGTCAGTGTAAGTTGG