Description :
From Genome Similarity Track
Location :
scaffold_860:5634- 10336
Transcript NameFunction/comments
Pl_102091hypothetical protein PHYSODRAFT_321724
Pl_102092hypothetical protein PHYSODRAFT_321725
Pl_102093proteasome subunit beta type-7, putative
Pl_102094hypothetical protein PHYSODRAFT_353469

Sequence
4702 bases(100 bases per row)
CGGCGTCGTTGTTGGTAGCGTCGACGGATAACCAGATCATTATCGCGGAGGGCGGACGCTACGACGCACTAATTTCGCGTTTCAAGCTCACGACTGCCTA
CGCGAAAGCCTCTTCGGTGGCTGCGATGGGTGTGCGCTTTGCCATCGACAAAATTGTATCATTACTAGCTGAATCGATGAGTCCTGCGTTGCTGGAATTT
AAATCACCAGCTTCGGAAGTACTGACGGGTGGCCGCAAGGTTCTAATTTGCTCTGCAGGCAAGGCATCCGACACGATGCTGTTTCGAATGCAGATTGCGA
TGCTCTTGTGGGGACAGGGTATCGGTGCAGATTACCTACATCCAGAACCACTACACCTGGAAGACCTTGAGGACTACTGCGCACAGCAGCATGTGCACTG
GATGGTGATTGTACAGAAGCACATGATGCGAGAAAAGCAACAAGTGAAAATCCGCGCGGTGAAGAGCCATTCTGAAGCTGATGTGGTAACAACTGTGACA
TCGTTGCCAGAAAATATCAGCGAGTTGCTGGCCAACTTAGGCAAAAGTTCACATGGCGATGCTACAGCTGGTGGTCGTGGGCACAACCATTTCGGAGACA
GCATGCACAACAATAGTAGCAGTGGTGGCAGTGGCAACTCATCGTCAAGTGGTAGTACCCTACAACCTATCTTCGACGTTCGAGTGGTCGATGCAAAATA
CCAATCGAGGGATAGGAACTATCGCAACTATCAGCTCGATACACAGAAGGTTCAGCGCCGCGTATCAAAGTGGATCTCCTCCAGCTTCTCCTCGCGCGGG
GACGAGGCTATGAAGGTTTTGTCAGTAGATTTACCATTCGCATTGGTACGCGAAATGTCATCAGCGCTGATGGAAGAGGGGCGCAATGGCATCGACACTG
TATGCGCCAACAACCCACGATATCGGAAGCAACTCAAGTACACCATGGACGAGTTGCTATCTCTTACTCCCGAGTCCAATTCGCGCAGCGTTGGGCGTGA
ACGATATGTACTTTTGCACAGCATGGTGGATGATCGATACGACATGATGTCTCTCGCTCCTCCGTCCAAGTCTGGCCGCAAACGATAGAAAAGAGTAAAC
GAAACTGTTCAAGTTGAAGTCGTTCAAATCCCACAAGAGCCTCCTATATCTTATAATAGTACCCGCCAAAATTAATACCACCAAGAGCTCCTCAGTTCGA
AGTATCCGATAGTCATGAGCGATGATGAGAGTAAGTCGCAGCCGCCGGCTTTTGATCTGGTGCTGCATGTCAAGTACCTCGTAGGCCTCAAGAATAAGAA
AGAGGACTTCGAGTCCTGCATGACGGAGCATATGCGTGTGAGCGGCTTGTATTGGGGTGTGGGGGCCTTAGCGCTGCTTGGTCGGGAGAGCGAAATGGGA
CCGGCCGAGATCGTGAACTGGGTGATGCAATGCGAACACCCAAGCGGAGGATTTTCGGGCAATGTCGGTCACGACCGCCATCTACTGTATACGCTACATG
CGCTGCTGGTGCTGGCCATGCTGGGTGCTTTGGACCGGATCAAACGCGAAGAGTGTGCGACCTACGTGGCGTCGCTGCAACAACCTGACGGTTCATTCGC
CGGCGATGAGTGGAAGGAGATCGACACCAAGTTCACGTACTGTGCACTATCGGCACTTAAGATCCTGGACAAACTAGATCTGGTGGACGTGGAGAAGGCC
ATGACCTACATTGACACATGCCGCAACTTTGATGGCGGCTTTGGCAACATTCCTGGCTGTGAGTCTCATGGAGGACACATCTTCACGGCTGTGGGAGCAC
TGTCGCTGGGCTTCGCTCTGGAACAATATGTGGATGATGAATTACTCGGGTGGTGGCTCTGTGAACGACAGTGTGATTCTGGTGGATTGAATGGAAGACC
TGAGAAACAGGCTGATGTGTGCTACAGTTGGTGGAACATCTCGTCCCTTATCATGATCGGTAAACTGGACTGGATCAGCAAGGAAAAGCTTATTCAATTC
ATTCTAGCATGTCAGGACCAGGAAGATGGGGGCATTGCTGATCGTCCTGGTAATGTGGCAGATGTGTTCCACACGTTCTTCGGTATTGCTGGACTGTGCA
TGCTCGGCTACTTTGATCGTGAAAAGGAGAACCATCCGGAATATGAAGACATCCGACAGATTCATCCGACGTTTGCGATTCCTACTGACGTTGTAGAGAA
GTTGCAGCTGACAGCGGACATCATTATGCCTGAGGTGCACGAAGACTAAGTGTTCGGTGATGCGATCGGAACCTAGCGTTAGTTTGGAGTAGAAGTGTAG
CTGACCTGTAAGCAGAACGGATGGGTTGCCAACACAGACACTCGTTCGCCAGAATTCAGGTGCATTCTCTTTCGCAATTAGCCATTTCGGTCTCGTATCG
CGTTAGAATATCAGGTCAGCGACAGCCTGCGTCTACAATTCCATGGGCGTGGCCTCCTCAACGACAATGTTGGCAGGGAAAAGCTCTGTCTTAGAGCTCA
GGACACCTACAAGTAGCGGATCAACCAGAATACAACAATTAGCCTATCTGTCACTAACTCAACAGCAAACTGGAACGTACGAGTAGCTCCGCGCGGGATG
TGCGTGACGATGTCTCGGTTGATCTGCGATCGCAGCTCCGACACCTCGTTGGGCTTGATACAGTTAAACTCTTTGACCACTTCCACCTTGCCGTTCACCT
TCTTGATGGTCGTCACATCGACGTTGCTACCGGAGCCCAGATCGTTGAAAATACCGGCCAAAATGGCCTCCTGCACGAGCTTCTTTGCCTCGTCCTCCTA
AGGAACCAACAGGCATCCCATCAGACCTTACACAGTCAATAAATAATACTGCCCTCTAGCATACCGTCATGTCGTCCTTATAGCCATGTTCGAAGACCGA
CATAGCAGCGAGGCTTCCAGAACCCATCGTCACAAATGGTAAACTATCCGTGCTGTATAATTCAACACAAACCAACCCAGTCAGTGAATTTCCACCTAGT
AATATGCTCCAATTCATGAGCGAACCTTCCGTGGGGGTAGATGGTGTAGAGATGCGGACCCGTAACATCCACGCCGCCGAGAACCAATGCCGCCGAGACG
TGACCCTGGTACTGGAACAACATCCGCTTCAGCAGCGTCATAGCCGTCACCACGCGCGACTGCGTGTCCGTGTTCTGAAGAAATCCACTAATCAGAAAAC
TAATTCCTCGCCGCAATTCACTTCAACTAGCAACTAACGCACCAGGCGGTGCAGCTCCAACTGCGACGAAATGAGTGCTGTGGTGTTCTCCGTATCAGCA
GCTGTACCGGCACCACAGCAGTAAATGTTGGGCGCAATGTAGTGGATCTTCTCACAATTCTTGTCCATGACGATGGAGCCGCCCGTCGAACGCGTGTCAG
CGCCGAGAACCACACCATCCTAGAAATAATTTAATAAATATATTAGTAAACATTGTACAACAACCCTTGTGTTGCAGTGGCTTGCCTTGTAGACGACGCC
AACGATAGTAGTTCCCGTCTTGGTAGCTTTGAGCTTCTGTTTGCCGCCCGACTGACTCAGTAGCAGCTCATTGCGGCGGCAGTTGTCAAAGTTAAAGCCT
CCATGCAGCTGTTCGGCGGTCGGGAAGGCGTCCCCGAAGGTGTTCTGCGTGCGGCGGAAGTCACTCATGCTACTTCTCGGAAATCTTTGGGCTAAAGAGT
GAGGGGGGAGGGGGGATCTTAGTGATGCTTCAAATAGAGGGCTCGTGCTCTATTCAAAAAGATACGGTACTGTAATACTGTGATATCATATATCTTGTCG
TAAAGAATGAATCCATGTATAAAAGATTAGAGGGTTATGATCATTGGGTAAAAGTACGAGAGAAATCGGCTGCTGATTGGAAATAAACCAGCCGAGCGTT
TTCATTGGCTGTGCGGGACGCCGAGTCCCGACTGCCAGTCATTTGCAAGACCATAGTGAAGTCAAGTGAGCTTGTGCTTTGAGCCAACCAGCCAACGCGC
CCAACACCCAGCGCCTTCCACTTTGTTCCCACCGCCAGAAGCAAAAGCATTCGTTAACCATGGTGAGTGGCCCCTGCCAATCTGTCTATAAGAAGGAGGC
AAGCAACAGCAGGGGGAAAGCAGCGTAGCATCCAGCAGCACCTAACAGCGCAGTAGCAGGACTATCAGCCAGAACTCGACTCCAGACGCTTCCCCCTCTG
CCTTCAAGTAAAACCCACAGAGTTGCTAACGTCTTGCCATCGTTGTTGCCATTCAGTCGCTTGTCATCGGGCCGGACTTCCAGCACATTCTGCGTATTCT
TAACACCAACATCGATGGTCGCCGTAAGGTCTGGGTCGCTCTGACCTCCATCCAGGGTGTGGGTCGCCGTTTCTCCATCATGGTCTGCAAGAAGGCCGAG
GTGGACATCACCAAGCGTGCCGGTGAGCTGACCAACGATGAGATTGAGCGCATTGTGGCCATCATCCAGAACCCGCTGCAGTTCAAGATCCCCGTGTGGT
TTCTCAACAGACAGAAGGACTTCAAGACCGGCAAGCACTCGCAGATTGTGGCCAACAACCTGCAGGGCAAGTGGCGCGAGGACTACGAGCGTCTCAAGAA
GATCTACGCTCACCGTGGTCTGCGTCACTGGTGGGGCCTCAAGGTGCGTGGTCAGCACACCAAGACCACGGGCCGTCGTGGCACCACGGTCGGCATCCTT
GG