Description :
From Genome Similarity Track
Location :
Scaffold_70:56323- 61571
Transcript NameFunction/comments
Phyci_29764Hypothetical protein
Phyci_231771Hypothetical protein
Phyci_94493conserved hypothetical protein

Sequence
5248 bases(100 bases per row)
AAGAATGGTGCTCTCCGTGAAGAAGACCCTGGCGCTGGCGCTGTGCGCGACCACGCTGGCCGCCTCCGAGGTGTCGGCGCTGCGCCCTCACCCGCGGCGC
GCGCTGTCGGGCATCCACCACACGACCAAGTACGCGCCCAAGGTGGTGCAGCAGCACAAGGGCGCGCCGCCGCCGGTCGAGCAGGACAGCGGCTCGTCCG
AGTCCTACGACTCGTACGACTCGTACGACCTGGACGGCTCGGACTCGGCTGACGTGACGCTGCAGGGATCGGAGGAGCTGGACGTCTACAGCTCGCAGGA
CCTGGACCTGGACTACAGCGGCGACGCCGACCTGGACCTGGACCTGAGCGGCGACGGCGACCTGGACTACAGCGGCGACGGTGACCAGGACCTGGACCTG
AGCTCCTCGGGCGACATGTACTTCTCGGCCGACGCCAGCCTGGACTCCAGCGACGAGCTGGACGCGGAGATCCAGTTCCAGGGCTCCGTGGACGTGGAGC
TGGACGACTCGGAGGACTACAGCCAGGAGCTCGAGTTCGAGGACGACGAGGTCGTGGACGAGATCATCGACGTGCCCGAGGGCGCCAAGTCCATCCACCT
GCGCGTGCACCGCGGCAACGTGGACGTGGACATCATCAAGGGCGCCAAGAAGCACGCCAAGAAGGAGACGCAGCCCGAGCAGAAGAAGGAGGAACCCGCG
GCCCAGCCCGAGCAGAAGAAGGAGGAGGAGGCCGCCGCCACCGAGACCAAGGAGGAGAGCGTGTCCTTCGCCGCCGAGGCCAAGGAGTGGCTCGAAGACA
ACCGCCACAACGGCGCGCTCATCGGCAGCGCCGTCGGCGCCCTCGTGGGTATCGTGGCTGTGGCCGGCGTGGCCATCGCCAAGAGCCGCAAGCGCGCGTC
CGAAAAGTCGGTGCTGGCGGAGGACGGCGCTGCCGACGCGGAGGCCGAGGCTGAGGTGGACGAGGACGCCGAGTCGGACAGCGACGAGGACAGCGACGAG
GACGTGGAGGCCGGCGTGACGGCACTCACGGAGGAGGACGCCGTCGCCGAGGAGGAGGAGGAGAAGAAGTCGAGCGTCGTGGAAGGGTCAGTGTAAGTTG
GTATCGGGCAGAGCCGCTCAGACAGACGATGGATGGGTGCACATGCAACGAGTAACGAATCGTAGCTCCGGTATATTCTATGGCAAGGTGTCGCCTTGAG
CGCCGCCGCCCGCCGGAAGATCGCGGCGGGCGGCGTTTCCCTAAATCTCCGTCAAATTTTATATTTTCAGCATTCGTTGTCGATGTTTGTGTGCTTGCCG
TGTGGCTCGCGTCCTCGCCGATAATGGCTACATCAACTTGATTTGACCAGGTCAAGAGGTTGAAGTCGCACGAGGTCGATGCTCGCCATTGCGCAGAGCC
CATGGCCCAGCGAGAGCTGCTCCGCGAACTCGTGGAGCGCAGTCACGAGCGCGTGACTCAGGTGCGCGCCGGCAGCAGCCTGCTCCACGTCCTGCAGCAG
CAGCAGCTCAGCTCCTCCACCTCGCTGCCTCTGCTGCCGCCGGCGCCGGCACTAGCAATCGCGTCCAAGCGCCGCACCCGCAAGACCATCGATGCGGAGT
CTGTATACGACCACCACCAAGCTCGACGGCGGCGCGACGCACTGCCTCGACTTGCCAAGGACGTCGCCCAGCTGCCCGAGGCCGCCACGTCCTTCGAGCA
GTACCAGAGCTTCATGGCCAACAAGATTTACAGAGAGGAGACAATGCACCTGCAGAGCCGCCGCGCCGCACTCGTCCCAAAGGCCGATCTACTCAAGAAA
CTGGCCGCGGTCTGTGCTGCCGCGTTGAAGGAAATGGAGAGTGAAGAGGACGCGCCAGCGGTGCGCGAGTCGCTCCGAGAAAAGCTCGTGCGGGCCATGG
GGCTACTTCGAGGCGGGCGAGCGTTCGAGCAAGCCAAATCCCTGTCTCCACCACCCCCGTCGCCTCTCTATGGTGAGATCAAGAACGCGCATTTGGCCTT
CCTCCAGTTCAAGCGCGACGGCGTGGGCACAACGACGCAAAAGCATGTTCAGCCGTAAGTCTTGTTCGGGTATTTTAACCCTGTTGGCTACTAACAGAAT
TAACTCGTCGCTGTCTTTAGGGGCGCTGGGTTACAGGATGGCAACACGTCGACCAAGACGCCGATCCACTTTGGCGACCAAATTTGCCTACTCTCCTCCA
GCTTCGACTTGCCTCTAGCTATCGGGTCTGACGGCCGCAGTCGTCCCGCCGAAGATAGCTCTGCTGGTCCGCACATGACTTTCACTATCGTGCGTTGTTT
AGCTGTTGCAAAAGCGATGGGGACAACACACAAGGTCTAACTTCGCGTTTGTGTTGTTGACCCAGGTGGACTTCCGAAACCCGTCTCGCTTCGACGAGGT
CACGTCCACGGATGACTTTTGGCTTCGTGTTGATCCGACAGTTCTGGCACCGCGCAGGTTTGATGCCCAACACCTCTATTTCGATTCAGGAAACGTCGGA
GCCTCGGACCCGACAGATGAAGATGGCGATGGTGACGACTTGACTTCGCTGCTCAGCGACACGAGCTATTATCTTGGTTGCCCGGGGTGGCTTGACGACG
GAGAATCCACCTTGACTTCTCCCCAAGATACCACGATATCGGCCCAAACGGGAAACACTCAGCCAGCGATAAACGGAAGAAACCCGGGAGACCATCGACC
TCACGGCCAAAAGCGCTTCCGCATTATGGCAATGAAGGCTTTAACACCTTCGAAAGAGTATTACGGAGATGATGCCGCCACGCGCGAGTATGCTGTGGAA
ACTAATGACAGCATTATGCGCTTAGCACGATGGCGATTTGTGAGATATAGCCCGCGGAAGCACGAGCAAGTTGGCGAGACGGAAAATGGCAGTATGGGCC
TTGACAGCGAGCAAGACGTGAATGACGCGATGGTGAACTGTTCAATTGTGTACCTTGTACTCAGTGATTTCACCCTCGTGTATGATGAAGAGATGAAGCG
AGGTGTAGGAGTACGCATGTCCTCAGACATTCGCGAATCGACTTCGGAAGTGCTGCACCTTCACAAAAATGGTCACGAACATGAAAAGAAGGAACGCAGG
CATCACCGTAAAGACAGCAGCGTGATTGCAAGCGCAATTCATCTTTCGTCGTGCGCGCGGTGGCAAGTGCGTATTCTACACCGTACTGGTGGGATCAACT
TCTTGCAGGAGCTGGAGTTGGCCATGGCAGCAGTCACCGGAGACGTGAAGAAAGAAGACGACGCGCGCGTGGAATGGCTTCGAAAGAAGCAGAACAAAAT
GGCCTCCAACAATCGCCGGCTGCACAAGAAGAGCAGTTTGGTGCTCAATGCCCGACGCCAATACGATCTCATCGCTGTCCAAAGCAACAGCAAGCTAGAA
CAGATTGAGCGTGAGAAGGGGGCCCAGTCGGTCGAATACTTCCAGCAACGTCTGAAGACATTAGGGAGGACGGAGAGTGGCCGTCAACCCTATGAAATCT
TGCAGATGAAGCAACAACAACTCCAACGAGTAGTTGAGCTTCCACACATATGAGGAAGGTAACGATACGAAGACATTCAACGCGAAGGAAGAGGAAGTAA
TCGCTATAACAATACGAGCAATATCCTTCTTCTCACTCCTCCTCATCTTTACCAGACTTTGTGTGGGCATTCTTCTTGCGCTTCTCGCGCTTCCGACGCT
TGCGGTTCTCCTTTTGAGCGGCAGACAGCACCTTCCGCTTCTTACCAGTAGTAGCAGCAATCTCAACTGGTCCCCCATTTTCAGTCGAAGATGCCGGAGC
TTCGACGCTTGCAGCCGCCGGAGCGTCGGTTGTCTTGTCACCTCCTTCCTCTACAACAACCGCAGTGCTGCCAACTCGATCAGCTCGCTCGAAGTACGCC
ACGAAAAAGCCGTTCGTCGAGTCCTCAAGACCGTTCGCGCGAACAAGTGCCTTGGCCTGCTCTGCCGACAGACCGGCGACCTCAAGCCCACGGCGCGGCC
ACGACGTAAGGGCGGGCTTTAGCACAAATGGCCGAGCCGCTCGGACATTTTCCTCCGACTTTAACGCCGCGGCAACAACTTCCTCGTCTTCCTTCTGGAA
AATGGAGCAGGTAGAATACACCACGCGCTCCACTTGCGGGAACGAAAACGCCTTGCGCAGAGCCTCCAGCTGGAAGTCTGCGAGCGACTGCAGGCGCTTT
GCAGTGTCTTCTTCGTACTCGGCTCCCTCTTCGGGCTCCAGTACGGTATCACGCGAACTCGCGATGTCCAGCAAGTGATCCAGACGATTCGTCATCCCCG
ATCCAGAGCACGACGGGTCCAGCAAAATACTCCGCACGTTGCGGTACTTCTCACCGTCCACGGGGACCTCGAGGAAGCTCAACAGCTCCGCCTGCACGCG
CGTGGCAGCGCCGGCCAGCTGCATGCGGCGCTTGAGCAGCTCAAGACGCTTGGGCGATCGGTCGAATGCAAACACCCGGCGCTTGGGGGTGGTGCCGTCC
TCTCCGTCTCCATCCTGCTGCTGCAGCAGCATGGCCAGATGACTGGTCTTGTTGCCGGGGGCGGCGCACGCGTCGATCACGTCGCCCTGTTTGTCCTCAG
TGTCGGCGTGCTCCCCATGCAGCACAAAGGCCGGGAAGCAACTGGCCTTGTCCTGCAGCACGACCTTGCCGCTCTTGACCATGGCGTGCTCGTGCAGCTC
CGTGCCCGAGGGCAGCACGAGCAAGTCCCGCACATCTCGGTCGTGCTTGGCGTCGTACTCGCGCGTGAAGGCCTCGGCCTCCTCGCTCGACACCAGCAGG
GTGTTGACGCGCACGTAGCGCGGCAGGGCGAGGTGCTGCTGGCGGTTCTCGGGCGGCAGCAGTGCCTCGTTGGACGCCACCTTGCGCTTAATCTTGAGCC
GCGCCAGCGCCGCGCGGAAGGCCGTCTGGTGCTGCACGAGCGCCTTCTTGACGTAGCCGCCGCCCTGGATCTTCTGCCGGCCGAAGAGCAGGTCGTAGAG
CGCCACGAACACGAGTGCGGGCGGCTCCTTGGCGGTCTTTGGCGTCTTGAGCGCCTTGTGGCATTCGGGCACGGCCGCCAGCAGCTCGCGCAGCAGCGGC
TTGTAGCGCAGTGTCTCGCACACGAGCGCGAACGAGCTGCGCTTGTGCACCGTCGACTCGGCGTACGCCAGGCTCTTGAGCCCGCCCTGCCGCCGCTCCA
GCTTGTGCAGCAGCTCGGCCGCCTCCTTGTAGAGCTCGCTCATGACGC