Description :
From Genome Similarity Track
Location :
Scaffold_4:563177- 570321
Transcript NameFunction/comments
Physo_128269hypothetical protein
Physo_128270PREDICTED: similar to echinoderm microtubule associated protein like 5

Sequence
7144 bases(100 bases per row)
CATGGGCAACGCGCTGCTGCTCGCGGCCGTGAAGGACCGGCAGGCCGTGGCGCTGGCCGACGCCATCTTGCCGTTCGACAACCTGCGGCTGCACGAGGTG
GAGGCGTTCTGGCGCGCGTTCTACGACTCGGCCACGAGCTTCGCGCTGTCCAAGAGCCAGCTGCGGTCCATCTGCTGTCGCGCAGTCGCCAGCGGCGTCT
CCAGTCTGCAGGGCTCCAATGCGCGGGTTGCTGAGTACGCAGACGCTGCGTTTGAGCTGTTCACCGACCCTTTCATGCAGCGGAGGTGGTCGCAGCTGCA
GCCAGGCGCTCGAGGGCTGCAGAGCCAGCAGTACTCGAGCGCGAGCGACAGTTTGGCTGCAATTGACGCTCTCGAGTTCCTCTCAGCCATTGCGTTTATT
GCCGCAATTCCGCTGGACGAGAAGATTGACTTGTTGTTTGACTCGTGGGATATGTCGGAGGATGGCGCGCTGGACCTGGACGAGTTCACCATTTCGTTGA
AGTCGACGCTGTCGGGACTGGCCAAGATCATCCAGCCGGTCGCGCCAAGCCTCGCCACGAGAACCACAAACGTGGATCCGGTTGTGGATGAAGACGAGAT
TATCCTCCTGGCGGAGTCTAACTTCCGAGAAATCGCCAACTGTGGAGTGGCCATGCCAAAAGAGAAGGTGACAGAGCAGGAATCGGTCACAATTACCTGT
GAACAATTTCGGGAATTCTGCGTGAAGAATAAGCGAGCAAAGGAGCTCTTTGACGTATTTGACGTAGCTGATGCTAGCCCCGAGAATGGTGATATTGGAG
GAGAAGCAGGAGGCCCGGTGGAGACTGCAGAAACTGTCGGGTTGGCGGCCAAGCTGGACAAGCAGTGTGATCCCTCTGAATCTACGACAGTTGAAGCTGG
TGTGTTGGTGGACACAGCGCAAGATGATGTCGGTGACATGTTTCTAGCAGTGAAACCATGGGTCGGAGCTATTGTACCTCCGAGTAAAATCCCGCCACTT
TCCAAAGGAGCCCCGTTGGTCTCAATTCAACTGGACTGGATATTTGGCTATAGCGCGCAGGATTGCAAGAACAATGTACGCTTCGCCTCAACGACGACTG
GGGCCAAAGTGGGACGCTTTGAGGAGATAGTATACCCAGCCGCTGCAGCTTGTGTTGTCTTAAACAGCAAAACGATGAAGCAGCGCCACCATCTAGCTCA
CACTAATGACGTGCTCAGTTTGTGTCTGCACCCTCGTCTTCCTCTCGCTGCAAGTGGTGAAATTGGCAAACAGCCCAAGATTATCGTCTGGGACCTTGAG
GCTATGGAGACACAATGTATTCTGCAAGGGTTTCACAAGCGCGGTATCTTGCAGCTAGCGTTTCTGACCTCTGAAATGCTGGTATCAATTGGTGGTGATG
ACGATCACAGTATCGCAGTGTACGAGTCGAGCAACAGTTGGAAATCAGCCGTGCTGAAAATTTCAGTGAAAGGCAACAAAGCGGCTTCGTTCCACATCAC
TACCAACCCTCGAATGTCAAGGGAGTTTGTCACGTGTGGTCAAAAGTACGTTGAGTTTTGGTCACTCGAAGGGAAAGAACTTGTCTCGAAAAAGGGTTTG
CTAGGAAAGAAGGGATCCCTGCAGTCATTCCCTGTGGCCCAGTATCTCGAAACAGCGGATCAAGCTGTCGTGGTTGGAACAAGTGATGGTTGTTTGTACC
TTTTCGTAGGACGACAACTGACGAATGTCGTTAAGGCTCATGAAGGCGCTATTACTGCGTTGTCTTACTCGTCGGGCATTTTGTTATCGGGAGGGCGAGA
TGGTCAAATCGCTCAATGGGATGACAAGCTGAAACAAATAGGACCTCCCATCCAGATCCAGAATGTCATTGAAGCGTCCTCACAACCTCAGCGCAAGGCG
GTTCGAAGTTGTTGTTTCTCACCTGACAGGAGAACGATTCTTGTTGGCACCTTAGCGTCCGAAATTTACGAGTTGGATGCTAAGACGGGTCAAAATGTAC
ACATGGATGCTCTGATGAAAGGCCACTTCCAGGGAGAATTGTGGGGATTGGATACCCACCCCACAAAACAACAGTGCTGCACAGTCGGAGATGACCAGAC
ACTTCGGATCTGGGACTTGGTAGCGCAACATGAGTTGGGATTCGTAGAATTGCCAATCCCAGGGCGTGCTTGCGTTTACTCCGGAGACGGCAAATTGATC
GCGGTTGGTCTTGGAACTGAGGACTCCGGGAAAGCTGGAAGCGGATCTCAATCGAAAGGAGGCAGTGGTAAGACACGACAGCCAAATGGAGGTTTCGTTG
TTTACAGTGCTGTTGACCTAACCTGTGCAAAGGAGCCCTGCTTCGACGCGAAACGCTGGGTTAGCGATATTAAGTTCTCGCCCGACAATCGAACCCTAGC
GGTTGCAAGTCACGACTCGAAAATCTATCTGTATAACGTTCTCAAGGGATTCTCGCGTACTCACGTATTTAACAAGCACTCGAGTTACATCACGCATATG
GACTTCTCGCTGGACGGCAACTACTTGCAGAGCACTTCGGGTGGGTACGAGCTCTTGTTCGCTGAAGTGAAGACTGGAAAGCATATTACCAATGCCACAT
CGTTTCGGGATGAGTTGTGGCACACTATGACTAGCACGCTGGGGTGGTCCGTGCAAGGAATTTGGGAAGCAGAAAGTGATGGCACTGACGTGAACGCCGT
GGACCGATCAAACAACGGAAAACTACTGGCAACTGGCGACGATTTCGGAAAAGTAAAAGTTTTCCAGTACCCTTGTGCCCTGGAAAAAGCGTCATCTCTC
GAGCTACGTGGGCATGCTTCCCACGTCACCAACGTCAGATGGTCTGCCGATGATAACTACATTGCTTCAGTTGGTGGAAACGACCGATGTCTTTTTGTCT
GGAAGCACGATAAGGAGCCCACGGGGAAAGATAATATTCAGCGACGCTATAGCGATACTGATAGCGACAGTGATGGAATCGATTTACTGGATAAGAGAGC
TGATGACCCCTTGGAAATTGCGGCAACGAACGATGATATCGGTGATGAATTCATGGCGGTACGTCCATGGCTAGGAGCTGTAGTCGCTCCAACAAATGCT
GCATCGATGAAAGTGGACAGCTCATCGCCGCATACCAGGCTAGAACTGGAACGAGTACACGGCTATCAAGCTCAAACTGCTTCAAATAACGCGCGATACG
ATTCGAACGGCAAAGTAGTGTACCATACTGCAGCTTTGGGCGTCGTATTTGACAGAAACTCTCAACGTCAGGCATTTTTCAAGAGTCACGATGATGATGT
TGTGGCGCTGTGTGCTCATCCGAATGGCACAACGTTCGCCACTTCACAGATGGGTAAGAAACCTAAAATCTACGTCTGGGACTCTGTTACTGGAGAAGCT
ATAGTTCCCTGTCTAGAAGGATTTCACCAGCGGTTCGTTAACACGATTTGCTTTTCAAGTGATGGTACAAAACTCGGAAGCGTTGGGGGTGACGACGACC
ATTCCATTGCAATTTACTCATGGCACACTGGAGTATTATCCTGCCAATCTCGCGGTGAGCGCAACAATGTGCGTGGGATCTGCTACCATGCTGCTACGAA
GGAATGGGTGACATGCGGCGACAAACACATTCGGTTCTGGACGGAGCAAGGGAAGAACCTCACGTCAAAGAAGGCCATCTTCGGAACGAAAGCGTATCAA
AACGGAAAGGTGCCGTCTGTCTTCGACTGTGTCGTATCTTTCGGACAAATGGTTATTGCAGGTGGCTCGAGTGGACACTTACTCGTCTTTCAAAGCTCGG
TAGACGTAACCAAAGCCATTCCGGCGCATGAAGGTGCTGTACTGGCACTGTATGCGACTGAAAGGGAGCTAATAAGTGGCGGGAAGGACGCGAAGATTGC
CGTTTGGGACGCCCAACTGAACAAAGCGGCTTCTTTTGATATGAAAGAGTATACGCTCCAGGGAGCCAAACTATTGAACCCAGAAATCCGAAGTATCTGC
TCCAGTCGGTCTTCGCCCAGGGTGTTTTTAGTTGGCACTGGAGGGAGTGATCTACTTGAGCTTGATGCTGGACGCGCTCAGCCAACGTTGTCAACAATTA
CTCGAGGGCATTTTAAAAGTGAAGTCTGGGGGCTTGCGTGCCACCCAACCAAGCAAGAGTACTGCACAGTTGGAGATGACCAAACTATTCGAGTATGGTG
CCTGGCTATGAAGGTTCAACTGCGAGTCCAACGACTAGAATGTGTTGCTCGTGCTTGTGCACTGACCGACTCCACAGACATTGTAGCGATTGGCTTTGGA
GGGAGAAACGCAGTCACTGGCTTAACCAAAGCCGCTCAAGCGAAGACAGGGGGCATCGTGTTACTGTGTTACACTGACTTGACGAAGAAGGTGTTCGAAG
ATCGACCGTCCAAACAAGCGATCAGTGAGATGAAGTTTTCCCCTAGTGGTTCTGTGCTTGCAGTTGGCTCGCATGATCACAAGATTTATCTGTATCGCTT
GGACCGGAATGCCACAAAAGTGACAAAAGCAGGCGTCTTTGACAAACATCAGAGCTACATCACGCATCTCGATTTCTCTGCGGATGGCCAAGTATTACAG
AGTAACTGCGGTGCCTACGAGCTCCTCTTCAGCAATGCTACTACCGGCAAGCACATCACATCTGCGAGCAGCACGAAAGACACGCAATGGCATTCATGGA
CATGTGTGCTCGGGTGGCCCGTACAAGGTATTTGGCCACCGTGTTCAGATGGAACGGATGTGAATGCAGTCGCTCGGAACTCACGCGAAGATTTATTGGT
CACCTCGGACGACTTCGGACTCGTCAAGCTTTATCGCTACCCATGCGTGGCGAAAAATGCAAGTTCGTTGGATCATCGCGGGCATTCCTCTCATGTGACC
AACGTCCGGTGGTCTCACGACGATAGCTATGTCATTAGCATTGGTGGAAATGACCGATCCGTGATGGAGTGGAAAGTTTTAGGTGAAAACGAGCGTATTC
CAACAGGAACTGGAAAACAAATGAGTTTGGTAGAAGCTGAGGAAGCCACGGACTTGTCAGCAGAGTCAGAAGAAGAGGAGCTTGATGATCCTGCAGGTGA
TGAGTTCATGGCTGTGAAACCTTGGATAGGAGCAATCGTAGCCCCTACAAATGCTGCCACGCCCAACTCGCGCGAACCAGACGTCAAGCCTGAGCTTGAA
TGGGTGTACGGCTATCAGTCAGAGCTATCACAACAGAACTTGATATACAACGCACAGGATGAAATTGTTTACCACACCGCCGCAGTGGGGATTATCTACG
ACTCAACGAATCACTTGCAAAAGCACCATGTTGGCCACAACGACGACATCATCAGCTTTGCGGTGTGCGACGCTAAACGCAACCTTATCGCGACAGGAGA
GCGCGGGAAGAAGCCTGCGTTGAGGGTGTGGGATGCCCACACGGGCGAGCTACGCTGCGAAATGAAGGAATTTCACTCTCGCGGTATTGTATCAGTTGGC
TTCAGTAGTGATTCCACGAGGCTGGTTAGTGTCGGAGATGACGATGATCACTCACTAGCAGTTTGGAGTGACGCGAGCAATGGGTCGTGGACTTTGGCTA
AGCTCCTGGCTACTGGCAAAGGTGATAAGGGGGTTAACCGCTTTGCTTCCTTTGGGACGAACGCTGACACCATTATCACTGGGGGAGTCAAGCACGTGCT
GTTTTGGACTATCCAAGGAAAAGCCATCGCTTCGAAGAAGGGGGTAGTTGGCAAGCAAGGAACTCTTCAGACGTTCCCTTCCGGCTGCAACTTTGGAGGG
GATTTCGTGACGGGGACGGCAGGTGGCGAGCTGTACGTCTGGCGAGGGAGTGATCTCTCTCGAACGGTGAAGGCTCACGATGGAGAAGTTCGTGTTGTGA
CAAGCACGACTCTATCCGATAACCCTGCTGGAAAAACTGCAGTGCTGCTATCAGGTGGGAAGGATGGCCGCGTTATCATGTGGAGCTCTGCGTATCAATC
GCTAAAGTGCTTCGATCTGGACGCAATGCACGTCGGTAGCTTCGGTAGAGTCATCAACAGTGTCTTTCTCAACTCCACTGGCAGGAATCTCCTTGTCGGC
ACTTGTTCCAGTGACATCACCGAGATAGACGTGTCAAGCGGAAGTGTTCTGAATGGCGGCCAGCCACTTTTTTCCGGCCATTTCGCGTTGGAACTCTGGG
GGTTAGCAGCACATCCGTCTCAAAGAGAGTTCGTGACGGTCGGCGATGATCGGACACTTCGAATTTGGGATATGGACGCGAAGCGCTTGATCCAGGCACG
TGCTATCCCTGCAAAAGCTCGAGCATGCGCGTATTCGCCCGATTCGGAACTTGTAGCGGTTGGCTTTGGTGGCGACAACGGTGTACGGCAAAGAAGAAAG
TCAGCAGCACCTAAGCAGGGCCAAGCGCAGTCGAGAGAGGGTGGCTTTGCTGTCTTGAGGACGCGCGATCTGGACACCGACAAGATCGTGTTTGAAGACA
AACCCGCCAAGGAATGGATCAGTGACGTCAAGTTCTCACCCTGTGGGAACATTTTGGCTCTAGGATCTCATGACAACTCCATCCACCTCTACTCCGTTGG
CTCCGGGGCGTCGGAATTCAAGAAGCGCAAGCCATTCAGCAAGCACAACAGCTACATCACGCACTTCGACTTTTCCGAGGACAGCAGCTACCTGCAGTCA
AACTGCGGGGCCTACGAGTATCTGTTCTGCGATACAGCATCCAGTAGCCACGTGAGTCGAGCGTCATCGATGCGGGATGTCAAGTGGGCGACCTGGACGT
GCACTTTGGGCTGGCCCGTGCAGGGAATCTGGCCGGAATGTGCCGACGGCACTGACATCAACGCAGTGTGTGCGTCCTCATCACGCACGATCCTCGCGTC
CGGAGACGACTCCGGCAACGTCAAGTTCTTCCGCTATCCGTGCATTCCGAAGGGGGTAAGTGCCATCCTACAACACAATGGATTCACTCATCTAACCACG
TCTGTTGCACCTGCAGTCCAAGTTCATTGCATGCCGAGGTCACTCTTCGCACGTTGCAAACGTGCGCTTCAGCTTCGACGACAAGTACCTCATCTCCGTC
GGTGGCAACGACCGATCCATCTTCCAGTGGAAGCTGTCGTAGCC