Description :
From Genome Similarity Track
Location :
Scaffold_191:56315- 57449
Sequence
1134 bases(100 bases per row)
tgtagtgggcctactttgaatcactactttagcttacacgtctcgctacgtgtatgaggaagcgtaggagtttacgatttaattagaataaaatatactt
gagtcctcaagtataatataaatcaaataaaacaccaagtagctagtttaaggtaaaatgagaactgtattgtttgtaaagtgatattcctcctcaatct
gctaaaactgtttatcatatatgaaaggggttgacagcggctggctgtcagagctccaccaatatgcacgtctctaattggtagaaatatgctgctttct
accaataggatctttgggtaggtgtggaccactcattgtggcggcccacttcaatgaatccattggtgtgacttacaccaaggtgaggaagaatctaaaa
cttttaacatacatcttatctattaaaatcagaagtggcttgtagccacttgtgtgtataaccccgttacaccatccccccttaaggttagacgcgcggg
gtccccgcacgtcaatctctgaattgaccattcgtcatcctccgcgtttggagaagaaactcgcgctcattcaacgatgagcgcgcctcaagaaaagaag
actctgaagtcgatagagagtcacctctccatcgatgagtactacgagcgccagacgccgaagtacggtgacgtcgtcgacttcggcgacgacgacgaag
acatggaggacgagaaggactcgtcctcaaagcacaaagactcagtgtcgagtgagtcgctcgatccccacgctcggaatgtccgaccgtgtgaggggga
cgaatcggacgctgcgagctcgaagcgctcacgaactgagatcgataccccactcgcttctgctggggctctcagttctccgcgcgctgcacctgcagcg
cgtgattccaatgctcaaggctctccgcgcgtgcctgcagcgcgcgatccgtggatgccgtccgcgtccgagatcacggactggtacgggaactcggtac
ctccgaatgaggtgccgctatacgtatgcagcgccatcaaagacgacgccgtggatgccaagctgcactttgatgcggagaCGCATCAAAGGCGCGATTA
TTACATCGGACGCTTCCATGAGCTCCGATGGTTT