Description :
From Genome Similarity Track
Location :
Scaffold_986:5631- 6866
Sequence
1235 bases(100 bases per row)
CTCTGCGTCGAGCACACCAGCCACGATGCCTGACTCCGTAAGCAAATGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTC
ACCGGTTCCTTTGGATCGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAATGCTTGGTGGCGATACACAAACT
CGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTT
CTTTCTCCGATCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGTATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGT
TTTGTTAGCGGATCTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCT
CTTCCATCGACAGAGTTCCTCCCAAAAAAGGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGG
CTCAATCTTCACTTAAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAA
AATTTGCGAGATTGCCAGATCCAACTTACCAATTGCGCCCAGACACCGACTAACGGAGGTAACTTCCGAAGAGCTCAAGTGGTGAAGCTTGAGCGTCTTA
GCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGTAATATCGTCACTCTGCGTCCGTGGTTGGTTCTGAATCCTAAGCGAATATTCGAGCTTATGGATCCT
CGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTTCCTTGCCTTTACGTTTCCTTTTCGTCGGACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTT
GAGAGCCTCTAGGGTGTAGCCGGCCAAGTAGTAAATTCGGTTAGCCTGTCGGATCTGCACGTGTATAGAAAATCTCACTAGGTTGTAGGATCTGGCCAAT
GTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCCGAGCTCGTACGGCCAATGTAGTTCCTATTCTTGAGGGCAGGAAGGCA
CTTGCGTGTTATTGTGCAAATAGAAGTCTGTATTG