Description :
From Genome Similarity Track
Location :
Scaffold_17:56302- 58407
Transcript NameFunction/comments
g4616.t1POM70979.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora

Sequence
2105 bases(100 bases per row)
GCAGTTAACTTTCTCAGTCATTTATTGTTAATAGTTCCGTGTTTGGTGTGGGCTTAGGTACCAATGCCCCACGTGCGCTATCATAGCAGCACTGCATGTA
GTAAAAGCTTGTACAGTTCTGCGTGTCTGAACGATGAAGTCGCCGAAGACCCCGAGAAGATGACCACAAAACACCGCCGACACTAGGTTCGCCGGCACAA
ATGATTGGTAGCGAACCGAGTTTCGAGTGTATGGAAAGTTGGCAGCGACAGTCTAGCTCACCGCCGTGCGAGCTGTGGTTACCGTTAGTGAGGTAACCAA
CCAGTCCTCCGCCACTTTCGCAATGGGGAATTTTGTAGCTCAGCAACCAGAGCTCGTACGAAGGCAAATAGAGGATTGGAAAGCCGAGGATCTATCTCGT
TGATTTTTACTCCTAAAACCGAGCGCGGCGACTGCCCGCCACCCGGTCTTATCAAGCAATCTGTATGAGCCGTTGGTACAGTTGTGGCTCTTAAAAGTAA
CATGACAATTCAACGCCACGACGATCTTAGAGAGGGTGGACCCAGTGAGCAGCAGCTCGGGATGTTGCATTTGCCAATGGCAGACTGCCATCGCTGTATT
CATCGGGAAGGTATCTCGTATCAATTGGACATCGAGAAGGACACTCGCGACGAACCTCCGACTCGACGTCGTGGCAAATTAAAATTCCGCTGTCTTTTGG
TGGTACATAAGGTCAAGGTACAAGTTCAATTCGGCGCGACAGCAGCCAAGGTTATCCGGACTCAGCGCACTATGGTCAATCAGCTCTAAGATGGCGCTGT
TGAAGCTCTCTGGAGCGAACGATGAGGTTCCATCGTAGTCGCCTCAGTAATTATGCAGTGGAGGGGAATTGCAGGCCTGACAGTACTTTGATCTAATGGA
ACTGGTGAAAACGGAGATATTGAGGCAAATAAGTAAGGATGTAGGAACTGCTGTAACATTAGCATACTTTTCTCCGTAGTACATCGATTACCCCTTTGTG
TGCTGATGTTGACAGTACCCTTTTGTAGTCTCCCAGACTACCCATTTACAGTAAAATTCAAAAAGGGTACGGTTTTCAAATGTCCCATTGGCTGCACCCT
GTGTAATGCTCTGTAGGAACTCAGCTCGGTCAGAAAACTCTCGAGCAGACACGTTTTGGGGAGCTCAGCTCGCGTTTTGTTTTACTGCATAACCTCTGTC
CTAAGCGAGGTTGTGTCCTAAGCGAATTCATATTATAGTCAATAACCTTGTTTGGTATCATAATACGTGTACCGGTACTCTACTGGCCGTCACTGACGAC
GTCAGTGGCGATTCGGCGTGGCCAAGTGGCCATGCAGCAGCGATTGTGGGTCCATGCATAGAGAGGCGGTATCGTCAAATGAGGGTCAGCATTGGTGACC
TGTGATGAGGGTCATCATCTGTGACCAACCTCGCCTGTCCTGAATCAGGTACGGATGGCGAGGACTGAAGGAGAGATAATCGTTCTCATGTACGGTATGA
GGATCTACATGCATGCGAAGCTACATGCTCTATCCCGGGAAACACCATGGGATCGGCATACCCCTGCAAAATGAAGTACAATATGCATGGATGGCCGGCC
TTGTACATGCAATTGCGTTCGCCTTTGTGGTAAGGTCGGAGCGTACCATGCATGGTTTGCTTCGAAAGCAGGCGTTCAAAGGGCAGTGCTTTGCTGTTCG
ACCCCATCTTCTGTTTCCATTCCGTATTTCGTCATCCAGTCCCCAAGGTGTTTTTCTTCAGTGCCAAGACCGACAATGCGCTTGCCTTCTATCCTTCTGG
TAGTGTCTGCGCTCACCCTTTTCGCAAGCGGCACCGCCTTATCTGCGGATACTGACAAGGGCGTGATGGTCTCCACGATGGCGTCCCCAGACTCTGGGTT
GCTGGATGTGGGGCACAACAGCGGGAAGAGGTTCTTGCGAGTCCACGAAACAGCCAATGAAGACGATGGCAGCGAAGAGAGACTGTCCGGTGCGAACATG
TTCAGCACGAAGAAGATCAAGCAGGCGATGGCGGACCCCAACTACGCGAAAACGTTGTTCCGGAGATGGAAGCGTAACGGAGTCGAAGCTGACGGTGCTT
TCAAC