Description :
From Genome Similarity Track
Location :
Scaffold_410:5630- 10300
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_410-snap-gene-0.5Callose synthase

Sequence
4670 bases(100 bases per row)
CCGACAGCAGCAGCACGACTCGGGTACCCCGCCTGCGGGACGCGCGCCGCCGCCGCCGACTACGACTGATATTTTCGAGACGCTCCAGGCCAAGTTTGGA
TTCCAGCGGAGCAGCGTCGAGAATCAGAAAGAGCACTTTGTCTACTGGCTGACCAACTACCAGCTCCGCGTGCAACACGAGCAGATTCGAGGGAGTACGC
TCACCGACATCGCGGCGACCCGCATTGCACTCGGCCGCGTACACAAGAAGTTTTTCAAGAACTACGTCTGGTGGTGCAAGTTTTTGCGCACCAAGCCGTA
CTTGGCTGGTGGCTCTGCGAAAGTGCAGCATGAGCAGCAGTACGTCGACGACGCGAACTCGGCACTCGTCATGGAGAAGCAGCTGGCGCTCTTCTTGCTG
ATCTGGGGTGAAGCTGGCAACATGCGCTTCATGCCTGAGTGCATCTGCTTTCTGTACCACAGTATGGCGAACAAGCTGGACGAGGTCGAGTACCTGCCCA
ACGTGGAAGAAGGGTTCTACTTGACAAGGATTGTTCGTCCGATCTACGATGTGATCTCGATCATGCGCACGGCCGCAGCTCCAGAAGGTGCAAAGCCGCT
TGACCACCAGGATGTGACCAACTACGACGACGTGAACGAGTTCTTCTGGACGACTGAGTGCCTGGATTTCGACGAACTCAACGTCGCGGAAGCGCTCAAG
GTGCATGACCCCAAGACGTTCAAGGAGAAGCGCAGTCTGTTTAATCCGCTGCTGGCGTTTTTCCGGATCTGGTTCTTCCTCGTCGTCATGTTCCACGTCT
TGTTTGTGATCGCGTACGTTTCGTACCGCGCCGACAACAGCGACAGCGGCGGACTGAGCTTCTACGGCAACTTCTTTTCGACGAGCCAGACGGATCTTCG
CGCGCACGCGATTTACTCGATTTTCGTCACGATCACGGGTCTGCTGGCACTGAAAGTGGGGCTTCAGATGTGGTTGTACGGCATGCGCATCTTCAAGGAC
GCATGGCTCGTGATCGGCGTGTTCTTCCGATTGTTCTGGCACACGTTCTTCTTCGCGCTCTTCGTGTTGGTGAACGTCTCGCCGAGTGAAAGCGCGCTGT
TCGGATCCAAGAGCTCGATTCTGTCTGGCGGTGGGGATAGCGGCACGTACCTCTCGATGGGTCTGCTCTACGTGATCGTATACAGCATTCCCGTGGTGTT
TTCAGCGTTCCTGCGAATGTTCTGTGCTCATGGTATCTGGAGCATCCGCATCTTGAATGGGTTGGATGGAACAAGACGCCAGTACATCGGGCGAAAGATG
GCACAGCCGTGGGCTGCGTACAGCCAGTATGCGCTGTCGTGGATGGTCATCTTTGTCTGCAAGTTTGCCTTCAACCTGCAGTTTATGGTCAAGCCACTGG
TCGGTCCGTCGATTGTCGTGTACGACATTGCGATCTCGGACGAGCAGCGCAGCAACGGGATCATCGAGTCGAACCACAACATCGCCTTCATCATCGCGCT
CTGGGTGCCAGTGTTCGTGGTGTACATGTACGACTCGCAGATCTACTTCATCTTGTTCCAGACGATCGTCGGTCTGGTGATGGGTATTCGCATGAAACTT
GGTCACTACATCGACCTTCCGCAGCTGAAGGCGGGTTTGTACGCGGCACCAGATCAATTCGATCTTCGAGTCACGACTACCCAGGCGAAGCTCGTTCAGC
AGGAGCCGGCCATTGTGTCCGGCTCAGGAAAAGTGGACGGCATTGACCATGTGCGATTGCGCTTCGCGATCATCTGGAACGAAGTGATCAGCAACTTTCG
ATTGAATGACTTATTGGACGACCGTGAAACCGTGATGCTGCAGTACCGCATCCTCGGCAAAGGAGAGCAGATCGAAGACCCAATCTTCCTACTCGCTGGA
TCTTTGACGAAGGCGATCACGCTTGCTTCATCGACTTCGACCAACAAGTGGGACACGCAAAGTCTGATCAAGAATTTCGAGAATGCGAAGATTCTGGATG
GCGTGAAAGATGGACTGTATCTCCTCCGCGAAATCTTCACGCTTCTTCTTGGGGACGCCGACGAGCAAGATGGCGCTGTAAGTGTGCTGGAGCACCTCTT
CAACTCGCCCGATATTGTGTCGCTGATTGACTTCTCGCATTTGCCCGAGCTTGCGGATGAAATCGAGGAGCTTTTGGGGACGATTCTGGATATGCCAGAA
GACCTTGCTGCTTTTGAAGATAACAATCCGGCGTACCAGAGCGCGCGAATAGAATTCCAGGTGCAGGTGGGCCAAGTGACTCAGTCTGTGCGCAACACGT
TCAAGATTATGGGGAAGATGCTGAACGATGGCTCGCTCGTCCGAAAGCTCGAAAACTGCAAGTTCCTTCAATTCACGCCAGACCTCGGGTACCAAAAGCA
GCAGTTGCTGTCGCTGTACCAGGCGGATGTACTGCTGCAGAACGGCTTCTTCTCAGCACACCGACGTGAAAATGACGAGAGTTGTGCTTCGTCGTCTCGA
TTCGCTAGAGAAGACTTCGTCTCTGGATGCACGCGTCTGTTCATCCTGATGCGCCTTGATGTCGCGAACTCGCTGCCGCGCTGTGATGAAGCGAAGCGTC
GAATGGGGTTCTTCCTCCACTCGCTCGCGATGGATATGCCGCAAGTGCAGTGTCTGGAGGCGATGCCTTCATTTTCCGTCATGACGCCTTACTACAGTGA
AACGGTGCTCTTTACGCTGGACGAACTGAAGAACCCTGTGCACTCGAACCCGCTTTTCGAAGCGATCGACAAGAAAGCGACCGTGAAGGGTCGTTCTGAA
CTCAGCATCATCAAGTATCTGGTCGCTCTTCATGCCGAAGAATGGAGCAACTTTCTGGAGCGTATGAGCGTGGGAACGTTAGAAGAAGCGATTGCGACTG
TCCCCATGCAAGTCCGCTTGTGGGCTTCGTTGCGAGGACAAACTCTTGCGCGAACTGTGCAGGGCATGATGATGTACGAGGATGCAATTCGCCTCTTGAG
ATGGCTCGAGCTGTACGCGGTCGCCGGCATGAACGAAGACACGAAAGCGTACGAGATGAGCCGAATTTCGGCTTTGAAGTTCTCGTACATCACCGGTTGC
CAGATCTACTCTCAGCAAGTCGCGAAGGGAGATCACCGCGCTGATGACATCGATTTCTTGATGAAGAAATATCCAAGCTGGCGAGTGAGCTTTGTTGACA
CGATCAAGGACAATGGTGCTACACGCTTCGATTGCGTCCTTGTGAAGTCCGAGGATGATGAAATTGTCGAAGTCTACCGCTACGAACTCCCTGGCAACCC
GATTTTGGGTGAGGGCAAACCTGAGAACCAGAACGTCGCGCTCCCATTCACCAGAGGCGAGTACTTGCAAACGATTGATATGAACCAAGAGCATTACTTC
GAAGAAACCCTGAAAATGCCGAACTTCTTGGCGACAGCTACTTCAAGCGGCGAAGAGGTGACAATCATCGGAATGAAGGAACACGTGTTCACTGGGCGTG
CGTCGTCGTTGGCGCGCTTCATGACGCAGCAAGAGCTGGTGTTCGTGACGCTGACTCAGCGTGTGCTCGCAAGACCACTTCGAGCCCGTATGCACTACGG
GCACCCAGACGTGTTTGAAAAGTCGTTCGTCATGACGAGTGGGGGTGTCTCGAAGGCGAGCAAAGGAATCAATTTGTCCGAAGATGTGTTCAGCGGCTAC
AACGTGACGCTTCGTGGCGGATTGGTGACGCACGTCGAATTCATGCAGTGCGGAAAAGGTCGAGATGTGACCTTGAGTCAGATCAATGCATTCGAAGCAA
AGCTGTCGAACGGCTGCGCTGAGAGCTGCTTGAGTCGTGAAGGACACCGCATGTCGAATAATCTCGATTTCTTCCGCCTGAATTCGATGTTCTACGGACA
CTTCGGCTTTTACATCTGTAACGCGCTGACTGTGCTCTGTGTGTACATTTACGCCTACGCCAAGCTATACGTGGCTACGCACGAGGAGATCCAAATCAGC
GCCGTAATGACCTCAAACAGCTTGAACTCGCTCGCCACCGTCATGAGCACGCAGTACATTCTGCAATTCGGTATGCTGACGACGCTTCCGCTTTTAGCGA
CGTTAGTCGTCGAGTTCGGTCTGAAGGAGGCGTCATTCCGCGTATTGGAGCTCATCTCGACGCTCGGAATCGTCTTCTATGTCTTCCTCACGGGAACGAA
AGCACACTTCTACGACGTCGCGCTGATTCGCGGTGGTTCCAAGTATCGAGGAACTGGGCGAGGGTTTGCGATTACGAGAGACCCAATGGTCAACTTTTTC
AAAGAGTACAACGTATCGCACTTTCGCAAGGCAGTGGAGCTGATCGGCGTGATGATCCTCTTCGGAATGTGCGGGAACTTCAACATTGGCGCTGGTGTGC
GTGCTGAATATTGTGCGTCGGTTGATTTTTGCGATGACTCGCCAGACTTGATTCCAGCAAACATCACGGCTCTGGATTCGTACAGCCGCTCGCCCCAGGG
CTACGGTGTCGCTTCTTTTGCGGTGCTGCTGCTCGGAGCTTGCTGGCTGATGGCGCCGTTCCTCTTCAACACGGATGGATTGGTGCTGAACAAGACGAAT
ATCGACATTTCGAACTGGTTCGCGTGGATGATGCGCGTGAAGCAAGACGACGATTTGATTGAAGACGACG