Description :
From Genome Similarity Track
Location :
Scaffold_271:563- 42377
Transcript NameFunction/comments
Phymu_g7844conserved hypothetical protein
Phymu_g7845hypothetical protein
Phymu_g7846hypothetical protein
Phymu_g7847hypothetical protein PHYSODRAFT_313263
Phymu_g7848hypothetical protein
Phymu_g7849hypothetical protein PHYSODRAFT_285513
Phymu_g7850hypothetical protein
Phymu_g7851conserved hypothetical protein
Phymu_g7852hypothetical protein
Phymu_g7853hypothetical protein PHYSODRAFT_491157
Phymu_g7854hypothetical protein PHYSODRAFT_313258
Phymu_g7855hypothetical protein PHYSODRAFT_497725
Phymu_g7856hypothetical protein PHYSODRAFT_496563
Phymu_g7857hypothetical protein PHYSODRAFT_259700
Phymu_g7858hypothetical protein
Phymu_g7859amino-acid acetyltransferase, putative
Phymu_g7860conserved hypothetical protein
Phymu_g7861conserved hypothetical protein
Phymu_g7862conserved hypothetical protein
Phymu_g7863hypothetical protein
Phymu_g7864HECT ubiquitin ligase, putative

Sequence
41814 bases(100 bases per row)
GCGTGTACGGACCGGAAGACTATCACGGCAAACTACAAAGAGACATCGCCTTGTACACGATCGAGAACCCAGACACTCAGTACGAGCACTCGCTCTTTAA
CACCTACCGCTGGCCGCAgtttggcagcttctccactaCCAATTTCTTCCTCCCGGTCTACAACAACGTGAACCACTGCTTACTGGGCGACAACCAATGC
CTTCACGACCAAGAGCGCCGCAAAAAGAACTTCTTGAAACTGGAACAAGCCCACTTCTTTGCCTCTCCTAATGACGAAATCCTCCGACCATGGCAAACTT
CCATCTTCGGACGCTACTCGGAAGTCGACTCGATTGAGGAGATCGCGACTGCCTTCAACAATTTGACTGTAGTTGACGTCAAGGACACTCGCGAATACAC
TGCTGACACCTACGGCCTGCAATCACTGGACAACTGCGGTGGCCTATTTCTCTACACGGTAGCCAACGTTTCCCACATGTGCTGGGTCGAAGACGCAGGC
GACTGCATCTGGGCGACTGTGTACGACCAGCACATCTACTCGACGCTGGTATAAAAGTTTTCGGAGCTCCGTGGGTACTAACTCAAACCGAATATGCGTA
AGGAAAATATTTTGGATGTCTCGAGTTGCCAAAGGGGAACTTAAAAATTGCAGGTTGCAGAGATAAACAAATTAAATTGATTAATTGGCAACACTACCAT
AGTTATCAACAAAACCCTTTTGCAGCAGCTAGGGTGTGCCCTCCTTACCCCCGCGCAAGCTAACGTCGCGTGTGAAGCCATATTCGATCTGCTGGTCTTC
TGGTGCCTCGAAATTGAAACCTACAAAGGATTCGCTAAGACCAGTGCCACTCCCGTCAACGCTTCCCAACGACATTTTCCTGAATTCGTCTCGAaagttg
ctgccgtcgaccTACAAACAAGGGAACATTCAGACACAatatctacatgtacttgcaAAGTAAAGATATAGCACCGGACGTACAACAGCATCGGAAGACG
CACAAGGCTGgattggagctggagcgtctCGGAAAGAGATCATCTCCCAGTCGATATGCTGGAAGAAAGGGTGCTCCTTAATCTCAGACCCGCCCAGCAG
CGAACCTAACCTTTCATAGGGGTTCCGAGTTAGCAGTCTTTGCAGTAAGTTCTTGGCTTCGGTCGATGTATAATCGGGAACTGAAAGCGGCGTTCGGAGG
ACTCGTTTGCACATTTCTCTCGCGTTTTCACTGTACCACGGAGGCAGTCCTGTTAGAAGTTCATAAAGCACTGCTCCGAATGCCCACCAGTCTGCAGCGG
TGCCGTACTCCTCTCCTTTCAATATTTCAGGCGCTGCCGCAGTAAATATCACAAGCAGCGTTAATCTCCACGGTTAAATACCACCGAGGATCGCATTACC
CACCTAGATACTCATAGCTACCACAAATAGTTTTCGCCCCGCGAGTAGCATCAGTTACCCCGAACTTGCTGATGCCGAAATCCACAAGTTTTAAATGGCC
ATCTTCAGTGAGTAGGATATTCTCCGGTTTCAGATCACGATACAGAATGCcatgctggtgcagctgctgaactgCGAGGAGTAATTCAGCAGCATAGAAC
GCAGCCACCTTCTCTGTAAACCTTGTGGCTCGCTCAAGATGCGTGGACAACTCTCCACCGGGACAGTACTCCATCACAAAGTACAAATTCCCTTTGGTTT
GAAAAGCCCAATGCAAATGAACTGTTTCAAGCACCACAGTCTTTTAGCATCAACGTATTTGATAAGCAGATAATATAGCAACACTACCCACCCAGTGCGT
GATGGCACGTTCCTCCCAGGACATCCCGTTCGGACAGAACTCTCTCCGCCATATCTTTCTCCTTCACCGATCGTTTCGACACAACTTTCATCGCGTAGAG
TTTCCCTTCTCTTCGGTGCCgaaccagcagcactcgccCCATCCCACCGACTCCAATCACTTTAATACGTTGGAAATCTCGAGGAGAGATACTGTCGCTC
GGTTCCTCAATTCGTTCCCCACTATTTCGCcccagcttcttcgctctccgCTTGACCaattgaagctgctcctgctcaTCCACCTGAGTCTCAATCCTGC
GGAAGGTGTGCCCTGTAGAGCTCAAGGCACTGGGTAACGCCATCCACACGCCACCGCCCTCCTCTGTATCATCACTGTCACTTTCGCTGGCAAATTCATC
GCTCTCCGAGTCCGAGAAGACTCCAGTTTCGGCTCGACATTGCAGCTCTCGTAGCCCCACAGCCTTCACAGAGTCCGAGCTGGTAGGTGTCGACTCGCGT
GACTGTTGGACGCCCATGGCGGACACTTTGACACTGATGCGGACTCTGCCATGCAGTGGAATCGCTTGTCTCAATTGAGCTCTCCGTCTGGCTATTTGAA
GTGGACTCGCTTGtcattggttgaaaagcGGCAAGAAGCATAAGACGCACAATAATGGGGAACCAGCTCAATTGTCTAGCGCAATGTCAGGCGCGACAGG
AAGGAGCACAGAGGCTACTAGTGCTGCAGAAAGGTGTGGAGAGGTTGCTGGTCGGTAGTGCGTGGTAGTAGAAGTTGTGGTTGCTGATTGAGAAGATTGT
CCAGGTGCCTATTTCACGCGGAAGAAGACCATTCTCGGGTTGAACACAGGAACGGAGAGGGTCCACGTGAAATTAGATGAGGACGGACACACGTGCGTTA
TCTATTGCAGTCGCTGGTATCTACCAAGTACTTACTGTTAGTGTATTGATGGACTGTTTGCGTTAGGCTGCtgtggaagctgcacgactCCATCAAGAAT
CCAACGAAGATCGAGCTACACAATGTGAACTTGATCCAGGCAATAGGTTGGCATTCTTTTTTCCCCCTGTCGTTGACGTTGGACATTAATATCTACGATG
TGGCTGCGGCTAGGCAAGGTTGAATTCTCCATTACATCTCAGAAGGGGGACACtttgctggacgtggaggccGAGTCGGAGGAAGTTCGCGATACCTGGG
TAGGTCTCTTACAGTTCATAAGATATGATCAATTCTGACATTGAATGCGTCTCCGTTCAGGTGACGCATCTGCAAATGGTGTGCGAGGACAGCAACCCCG
ATGATGAGACCGAGGAGGAAGTGCAGTCGGGAATGAAGTTTCGCAAGATGGTGGAGGATCGAGCCAAGAAGCAAGCGTACTGGACGAAACGCacggagga
actggagcagcggaaacaagaagcggaagagcggaagaagaagtttgctggtgttggcatGAAGTACACGGCACTTGCAATGAGCAACAGACCCGATCCA
TCAACCAAGGATTAGGATAATGCACGCTTGTTTTATTACCTCGCCAACACAGTAAAGGATTATTGTACCGTCGTGTTCGTccgctgtacatgtagtgtcT
TGAGTCCGAAAGTGTCCTCTGCTCATTAATCGCCATCCGGTCCATgcaacatgtacatgtaatacatgtactgcgtCTCGATCTTCCAAGCTATGGAATT
GTGGGCCATATAAAAAGGTCAATACTGACAGAGCGGTGCAAAACCATGGAAGTGGCTCcgacgctggacgatgcCCAAGCTCTCCGACAGTTAACGCTCG
CGGACGAGCATCTAGTAAGGCCGTCTGTCTGTTCTTGCTGGGACTGCAGTGCTGATGGGCGTTTCCGTGGTGGAAGATGATCTGCCTGTGTGGGGTGGAC
GTCGAGAGCGATGCCGACGCTCGAGTGCTGCAGGAAGCAGTGCAGAAGGTCATCCGCATCAAGCTGCAAATGGGGAGCTGTGTGAGTGACTACGGATTAT
GGAGACACGGGTGGAAGTTAGACCACTGAAGATGTTGTTACTGTTGTTTTAAGCACCAAGTGAGCCTTGCCAGGGCACAGGGATCACAGCTTGTTgtcga
gcaggaggtggGAAATTGCAACCGCATTTGCAAGGGAATGCCTGCATCTAACATTGCGTTATTCATACTGAAACAGTTCACCAGGGACGTTGACGCTCTT
GTGGCGGCCGTACCTAGGCTCCTCTGTTCAACTGGTCATGACGCTGTGGTCCTGGATTCTCTACTGGCACATACTGCTCGCCACTTCAGCGCACAGCGAG
AAATGGTGAAGCTCTATTGCTCTCTTATATATGCTGAAGAGCGTTAACATGTAGATGAATACGCTTGTAGGACTGtcaagctgcttcgtcaTTCCGCCTG
TTGTTCGTTTACAGACAGGTGAAGCAGGTGCGAAGGCTTTGTTTGTagcgtcttctgctcttgGTTACCCAGTCATGTTTGTGCAGACTCCACAACTCCA
TATTAGCCAGAGCGAAGTCTCGCTAGCGTTCATCAACGACCCCGCTTGTCATTTGGATGTCATTTACTGGCACCAAGACGTGCCGCTGGAGGCAGCCCAG
GTAAGTCCGATGGCTGCATCTCTGCTGAGTTCGCATTCACATCTTGTTTCAGCATGTATTCGACCAGCTCTGCGAATATGACAACACGAACCCACTTGCC
AAGTTCTACTTCCTAGAAGTCGGTGGGTCGGCCGAGAGATTGCACCAGGTACGCTTCGGTTCATTTTTTATTGTAAACTCATGATGCACATCGAGACGAA
CGCACGAGAGTCGAGAGGTGTGGTAGTCTAACACTTGAAttggttgttgctggttgGCTAGGCGttcgtgctgatgctgtcgcATCCGGCACATCGAATG
AGtcaaaatgctgctgaacaGCTTCTGGGGTCGTGGTTTTCACCAACCAAAGGGATCGACTCTCTCAGGCAGCAAAATTAAATAGATGGACAGGTTTGCT
GTCGGTCCACATGAATGGAACCCGTCCGTCGTCATCAGTGAggcaagcagcagtcagAAAActctgctggttctggttgCACCATGGCCGAAGCTGCCAC
TCTCCCTTATGGAACGTCTGCAAAAAAGTCGGAGATACcttcgctgtcgtccagGTTGAAGCAAAAATCTGGGTCGGTCTGCGCGTACATGAGGAAGCTA
AGCCATGGTTGAAAGCTCTACGTTTACAGTGGTGTGCTTCAATTACCTTTAATGGTGCAAGTTTGAAGATTCCGCTGTCCGAGTCGTATGATCTCTGCTG
TGAAAAGATCAAGCAGAAATATGAGTAACTCGCGTGAAGTACACTAACGAAAAGCTTCATCCACTCACCTGATCTAATGGAGGTGCAGGGCTATCGGGCG
CCAGTGCTCCAGCTTCCTTCGCTGACTCACTGGTGCCTCCAGCCTCCTTTTCATCCATGCGCCGAACTAAGTACACATCCACGGGCCCATCTAAAAGATC
CGACAACGATAAGCAGGCTGATCACCAACCGATAAACGTGAAAACTCAACAACAAGCCGTAGCCTCGCGCACCTGTGGACTTGAGGAAGATCTGAAATCG
GCGTTTCCCAGCAGGCAGGCCCTCATCTGGGTCAGGCACCTCGAGTGTTGTTCCCGGTGGTGCCTTGATAGCCATGACACTCTGATCTGCAAAACTCTCT
TGTCGTCGCATATCGTCGTGTGTGACATAGCAAAAGTTCTCAAAGCTGCCTTTGTCgaacgcttcttcttcgtacaAACGTCGGATGTTCTGACTGACCA
TCTTGATATCCTGGTCGTACTTTAGCTCCTCTTGCCTAAGATCGGAAATGTTTTGTCGGAGATGGTCCATGCCCTGGTAGCCGTCTGTAGTACCTGTAGG
CCCACTTGCACCCCTGCGTAACCATAAAATCATATTAGTTATGCCGACCGTCAGCCCGATGACACTCATTTTTTACACGCCGATCTCCATGTAGATACGT
ACTTCCAGTGGATGTTGTTTTTGGACGTCTTCTCAATCAACCCGATGCCTTCCAGTACATTCGTGATGTCGTATATACGTCGTTTCTATCATGCCACCTT
GCATGTCAGTAGCTACAACATCTTTCCTGCAATAGCAGCGCCTCCTACCTGAACGCCGAGCGATTCCGCTGCTGTATTCAAATCCAAATCTTTTGACGGC
GCAGCTTGGATCAGCTCCACAAACCGCTTGGTCAACAGGCCCAATGAGCTGTCGTATCTGCTGGCTGGGGATGGCTTCGACCCTGCAGCAATAATTGGCA
ACATGCGCGTCAACCCTTCAGAACTGCTGTAAACGACCAAACAATACCCCCTCTGCTTAGTCAACTGCAGTTAACGTAGAGGTTGGACGCACCGCGCGCA
CTGGGACTGGGAGACTGCAACTTGGGCGGTGCCACAGTGGACGATAACGATCTGGATGCGGCCGACGCAGCATTTCCAGACGTTGCGACGGGCGATGCCG
ATGCGGTCTCATGTCGCGGCTTGGGGCGCTTTATCTtgcgcttcagctcctcATTGGAGACATTGCCTTTAGCCATCTCGTCCTCGCGATCCGGTGATGC
TGCTACTTATCCTCCGCTGCTGTCCCTTGGAATCGCAGTATTCAGCCAATGGGACTACCAGACGGCATACAGCATACCTGCAGTAGAAACGGATGTAAAA
CCCGGTAAAGTAGACCCAATTTTCTCGATCGAAATGGGTAATTGTTTGCCAGCTGTTGGTGAAACCTCTCTCTTTTATAACCTTTGCGCTGCTTCCTAGT
GCTTATATCCCGGTAGTATACTCTCTACATGCGTGTTCTCGCCTCGAAAACAAGGCCATTATGCTTATGAATATgtctttcatcttcttgccaagttCGG
CACCAGATTCACTTCGGTTGGTGTGCTGAGCGCTAAGCGTTGAACCCACCGTTTTCACACTCGAGCTAAACCTGATACATTCGATGATTTGATATATTAT
TAATTATCCCGGAGATCGTTTTAGGCCAAAAAGTGCCACATCACCACGATCGATCGGacatcgagcagcaccatgGGCgcgtcgagcagcaccgCAGCAC
CGCCGGAGCGCAAGGGATCAGAGGACGAGATGGTGCTAAATGGTACGTCACGTAGATAGCACGAATGAGCGTATAAGAAGATCCATGCTGACACGTAGAT
GCGAGCAGACCTGCACATCGAGACGGGCGACCAGAATGCCGTCAAGAACCTGTTGGATGACACCATAGTCGAATTCTTCCAGGGGAAGCAGGATTTCAAG
CTGCACTACGGATGGGACAACGCTAAGCTGCTACTCATGCTGCTGGCAACAGTCATTGCGGCCGTGTCGCACTTCTACAAGCACCCCGCCATTTCCGAGG
ACGTGCTTATTTACTCCTGCGTTGCTGGGTAGGTGTGAACGGATAATGTTTGGTGACCTCAATATTCTGACTTCTGTTTACTATTTTATGGGCAGATTTT
TCTTGATCCATGCGCTCCTGTTCGGCTATACCATGCTTATTGAAAAGGATATACTCCTGCGGATTACTCGATCGGTAAGAAAGGTAGCGGAGGAGAATAC
GTTAGTGTTGCTCTACTGACTGAAATTGGCTGTTGGTGGCTAAATTGCAGGAGTCAAACCCAGGTAAGATGATACTGGTGCGAACGACTTTCCCTTACAC
GGAGTCGCACTACACCATCAGCATCCACCACGCTGACTCGAAGGAAAAGCCGAggaagcaggagctgtacgTGGGTCGTTACTTCGACAAGGATGGCTAT
TTCAGCAAAGAAACTTTCATCAAGGACATTGAGACCGTTCTGTCGCGctttgagaagaaggacaagaaacAGTAAGTACGATCTGCTGCATTGAATAGCG
GTTAGATGTCTGCCTCAGGGTTCTTGTAAGCTACCATCGCGTCGACCTTGTGGACCTGCACAGCAACAGTCATGCGCGTTAGTTGACAGAACGCAATGAA
TAAATCAGTCGATAAAAACGCAGCCATACTTTGGTAGTAAATGATCGCAGGCGCACTTCTGTGGAGTCCTTGATGTAGCGAGGATCCGACTCCTCCCATA
GCGCTGGTACTTCGGAGTTCTTGTCCGTGTATACTAGCAGATCGAACGCGCACTGCTCCTCCAAAAGAGGCAAGAATGAGACGCTTGCTGTGATCTGCCG
GATAATGGCCTGGATCTCCGACATAATCTCCTTCTGAGGCTTCGAAGCAGGCgtgctgccactgcaaaGACACACAGCACGACCACCTAAGCAATTATCC
AAACCATGATTTACAGCAGCTATACATACCTTTCGTTTGCACTGTTATCCGCGTGAACTTCAAACGCCCACCGCTCAAGCACTTCCTGCGTCTCAATTCC
AGTgatcaccagcaccagcttctgcacctcgCCCTTCAGAAGCCAGTCTGCATACAGAAGCAGTTTTCCGGTTCAGTAAATACAGCATCACGGAGTCAAA
GATAGGAGAATACGGACTCGATAATTGTTGGAGAAAATTGGTGAAGAAAGCAttgagcttgtcgtcgtccgtcacAAGCATGTTCAGGCCATACTTTCGA
ACCTGCTTGAAGCTCTCAGGAGGGTAGATACCACGCTGGTACAATATACTATTGACAAGCATGGGATCGTGACGAGTTAGTTGTGCTGCCAGTCATAGCT
TATAATTCTGCACACTTTTCGTACGTATTGATGCTGTATGAAAAGAACTCGGTGACGATCTCAGTTGAGCCCTTGAGCGTGATCAGGTTCTCTGAAACCT
GCGCTGTTGCCTGCAGTTGTAATCCACCCAACAATTATATTTTCAAAGGCGTGGCACAAGGCCCCTAACGCATTCGTTTCCTGACGTACCATCTTCCAGC
TTTTTTGGCACGATTGAAAATGAATCAGAGTGTGCTCTCCACTCCAACATCCTATTACATAGAATGTTGAACCTTTACTAAATCATACGTTGCAgttgac
catcactcctgcaGGAGAGGCAACGCCGCACTCCATTCCGCATTGCAGACAACAACTACAAAATGCCGAGAGCTCACGACCAGGTATAGAATCCGCATGG
CGTTGCAGCTGGGTAAAACGTATCTTGGCATGACTTACAATTGCACGCAGCGGCGTgcggagcaggaggaactCTCCGACTCGAGCGATGTTGAAGAAAA
CGACGAGGAACTGGTGTTTATGTCGATCCTTTTCGACCGAGGCGAGCTGGGTGTCGCAATTTACAACGCACTGGATACAAGTCTCAAGacactgcagctt
cagatAACCGATGTgcaggatctggaggaggtgaaaACCTGGGATTTGAATCTGAATGAGCTTTACAAGCTGATCAAGTCTCTCACTTGTTCTCTACTGT
AGATCATTGAGCGCCTGCACACTCAGTTTGAAGTGAATCATGTTCTCGTTTCCTCTCGAAATGCAAGCTCAAATGGAATGCTTCGGATGGTCAAGAAGCT
TGACGAAACGCATCAGTCGAAGACGGGGATCAGCATCCGGAGGGTAAATCGTGCTTGAACACCGTATATAGGCTGCCATAATACTGACGATAAGGGGTTA
TAGCATTCAGGTGGGCTACTGGGGTTATTTTGGAGGTGTGAGCCTGTTTACGAGCTAAATTGCTTCGCTGAGCAGATTTCAACTACCTAAAAGCTTGCCA
AGCAATTGAGCATGTCCAGATTGGTACCAACACCGACGAGTACAGGCGTACTCATGATCGACCACCCCGGTAACCAGTTTCCTTGTCAGTGATTTTTATG
AACAAATTTACGACTGGGGCTTTACAGGCGAGAAGCGTATACGTTCTTGGGGAGCTTTTTCGATTTCGAGAGCATCCAGCGTATTCGAGCTACTGGCGGT
AGGAGACGACTTGGATAAGACTGAAGTATTTTGATTTAATGCGTGGTTTGTAGCTTTACTGCTGTACTTATCCACCGAAAAGGTACGCTTAACTGAGGCG
GGAAAATGCATTCAGTCATTAAACTATCGAATTCGCAGATTGGGAATcagctcgacgacgtcgaaTCCGTGTATTTTTCAACGGTGGAGCAAGTTGCACT
CGACGGCTTCATGTATATTGACAAATCAACGCTTCAGTCCCTTCAGATATTCAACCACGTAAGTTGATACAGTGTACTGCGTTGTTTTAAATGAACTCAT
TCATTTATGCTCGGACACAGGAAGCGCACCCTTCACTTGTCAAGGTAATATTTTACATCGAAATACTGTTCTTCAGTGGATACTTCGAAGATTGTGCGCG
CTCAGTCGTTTTTGTTACTCTCTCCATATTGTGCCTGTGCAGGGATCTGGTCGAGCCAAGGAAGGCTTCAGGTACGATTACCCACATTTACAGTACTTTC
TACAATTTTGAAAACGTGCTAAAAGATCACAGTCTATTTGGCCTTCTTAACCGCACCGTGACCAAGTCAGGTGCATATATGCTGCGGCGTTGGATGCTTA
CTCCACTTGTAAGCGAATCCCAACTTTATGAGCGGCTAAGTTCTGTCGCATTTTTCACGGAAGCCGAAAACGACGAACTTCGACAGTTATTGGTAAAATA
TTCCAGTCTTGCATGTATATGATAGCGCAACGGTTAATGAGTTTTAACAAACTGTAGGTTGGaaagttgaagcgcttcagAGATGTAGCTGGAATCTTTC
AGCGTATTAAACGACGTTGTGCCTCTGTCGGAGACTGGTGCCGATTTTCCGCCTCCATTGCGAGCTTCCTGGAAACACAGTAAGCGTCCTCTTCATGTCC
CGCCACTGGGTACTAATTGTCCTGCATTGCAGGTCCCTCGTTGAAAACATTAGTGGTTCCAGCAATTCGACACTGCCCAACGTGTTCTCAAAAGCACTAA
ATGAGCGAGGGGTCATCCATGCTAGCAGCCTCCTCGGAAACGTTGTGGATTTCGAAGAaagccaacaagaaggcgtTGTCGTTATTCGAAGCGGTGTATC
AGAAGCCCTGGATTCTGCACGAGAACGCTACGAGGACCTTGACAATGTACAAAGATGGAGGAGTTCAGTGGAGATTTACATGCACTAAAAATTTACTGTG
GACAGGTTTTGACGGAGGTCGCATTTCAGGTTCAAGAGGCCAATCCAGTACTATCGTCAATCACAGTCCAGTACATCCCTCAAGTAGGATATGTCATCTG
CTGTGAGGCTCCCACAACTCTACCAGACTTTGTATTTCAATTCCAAGAAGACGACACGACGTTCTACTACAAGGTATGCAACCGCAGTTTTACCAACATT
TATTCGGATATACACACTTACACCACTACCTACAGGATGCTTGTTGCCGCGATTTGGATGAGTCCATTGGAGACATCTACGGTACATCTTGACCATATTG
TTAACTGTATCGGTTGTGTAATGAGCCGCCGTTCTACTCGCAGGATACGTTCTTGACATCCAAAGGGGTTGGACATTTCGACACAATGTGTTTTAAAATT
CCGTTGACTGACATTGATAATTTTAtagagcttctggaagagcttACAATGGCGTTGTTGGAATACGAAAGCAGTATCCACGGTCAGTTTTGATGATGTC
ACAAGCACTTGTGTCTGACATGGATCATGTTTGTCAGAAATGACCTGGATTATGTCGTTTCTCGATTGCTTGATTTCACTCGCATCCTgcgcgaagagct
tcaaTTTTACCCGGTACGTGCCAAGGGATCAATTGATACAAAGTTACAACTTACATTTGTCGAGTAGTCCGCAGATAACAGAGAACAGCACGATGAAGGT
AGTTCAAGCCCGTCACCCTCTCCAAGAGCTACTCGTTGAACACTACATTCCGAACGATATTTTCCTTGATTCCATGGACTCACTGAAAATCGTAACGGGG
CACAATGGATCGGGTAAGAACAAAATGTTTACCCTAGCTATATGGCAAAACATGACATTTTTAACTATCCTGCACTGAACAGGAAAATCGGTGTATTTGA
AAATGGTCGGTCTTCTGCAGTATATGGCACAAATAGGATCATTCGTCCCAGCGGAGAAAGGTAAGGCGCAAGCGAAATTATGTACATTCATGTGGAAGTT
TGTCTCTAACAACAATCTGCAGCGGAGATTGGGCTAGTTACCAAAATATTTACGCGTATTCAGAGGTAAGAAACCGGTTACTAGTAGTAACATGCAGGCA
CACTCTGGATCTGATCTTGAATGTTAAAGTATGGAATCCGCGACAGTGTCGCAGAGTTCCTTCACTATCGACTGCAACCAAGTACGTGAGAATATCTTCC
TTATTATGGAGGAGTATACTAACATTTTCTCCTTAGATGGCTTGGATGTTCAACCATGGAGACGGCCGCTCGATTTTTCTGATCGACGAGTTTGGAAAAG
GTTTAGAAAATTAGAACTGGGTAGATATTCGGACGCTAACTTCAGCAAATATTTGTTTATGAAGGAACGGCCGAGCTTGACGGAATAGCTTTGCTGGTAA
ACACAACATTGATTCGAATGTTTTGGTCAACCCTAACATTTTGGCGCTGCGACGTAGAGTTCGATCATCAATCACCTCGCCAAGAAACGCTTTACAACTG
GAAGGCCGCGTGTTGTGCTGACAACCCACTTTCGAGTACGCTTCTTTAGCTTTGTTTTGCGTCTGGTGCCACTGTACAGTGATGCTTGTTGTGACCAGGA
AATCTTTCGGGATAATTTACTTGAGCCGACATTGATAGTCAACCAGTCGATGCCTCAAGACGGTGTAGAGCAAAATGACGATATATCGCGAGTGATTTGC
ACCGTCATGGCATCTACGGATGCGCCAGAATCGTATTCTGcaactgcaagtgctgctccACTTTACGAACTTCGCGATGGTATCTCAAGTCACAGCAATG
CTCTAGCATGCGCTGCAAAGTGCGGTGAGTTTAAACCATTGATTTACATTGAAAGAGTAACAGCAAGATCtaatctgctgctgcttccacagGAGTACCA
CAGAAATTGGTTGAGCGAGCTCAGGAAATTCTAAATTGCACCAAGCGTGGGGTGCTGATTCCGTCTCGACAACAGTTGCCAGGACCATCACCGGAGGAGC
AGCTCGCTGCGTTCTTCACGTCAATTAACGACTGGAAAACTGCAGGCGACGAAATCATCGCCAAGTTTTTAGCGATAGCACGAATGGGGGCTCAGTGAAC
TGGTTGGCTTTTGATTAGATAATGAATTATGGTCGAAATACAGGCGACGACAGGTTTCGGAGGTGCCAACAGAATGGGTTCAATGAACTGAACACTTCAG
CAATGCACAACAGTTATTCGCCACATGCTGCCTCAAAGTCCACACCGAGAATGTCCTCGAGTAATCCGCCGTCATCGAAGTCAGTGTCAGGGAGATTGTC
CGGCGGCGGTAGTTCGCTGAGATTGTCTTCGACTTCGTTTTTCGCCTCATCTGTACCTGGATCCTCTGTTTCAGTCACTGTATCCGGCGAAGcccaccat
gaagaaggaggctCACCACTTTCGAGCACCGCCTTCTCAACGCTATCATCCCAGTCGTCCGCGTCACGCGTAGGTTCGATGTCATCAAACAGCGTCGGTG
TCTTGTCATTCAAGAGGTCTTCAATTTCACGAGACATTTTCTCTGCGATAGCGGACTTTGACTTGGGAGACGAAAGTCCGCCGTAGGCATGCTCGATATC
CTAATTGAGAAAGCAGTGCACGCCAAAGTGAGTAACTCTACATATCAACACCCAACGCGATTCTGCACGTACCggaacttcttcgccgcGCGGAATCTTA
ATAACACTCTCTGACGCCGCTTTTGTGCGTGGCTTTGGTGTCAGTGACGCCGGCTCCTTTGGTGCCAATGGTGTCCCCGATTTCGGCCTCAGTGGTGTCC
ACTTCTTGGCTATAATCTTCTTGGAGTGACCAAGACCTCTACCCAGTCCTGCCTTCTTAATTGATGCAATGGAGCCCGAGTTGCTGTTATCATGGCGGTT
GCGCTGTTTGTTCGAGATGTCACTTAGCACGCGTCTACTGCGCCAGCAAAACGTATACTCAAGTCAGCAAAAATTTAAAGGTGTCAGGGGATAAGCTCCA
AAAaacctcttcttcgacgtgctATCTTTCAGGCCTTTGTTGTCTGCCGACTTCGAGTCTTCATGAATCACAAAGCCGCGCTTCGGAGTTGAGAACTTGT
CAACGCCTGAGGGCGGGCACGAGGAGAACGGTTATTACACAAAATAACATTGAAAGGCGCAAACAGGCAACGTTTACGTACTACTGAAGCGCAGTTTGCT
GTCGCCTGTGCTGCCGCTGAAGTTGgcgtccacgttctccttctGTGCTTGCAGCGTGTCCATCTTTGTGCGTTTTGAATTTCCAAAGGCAAAATATAAA
AAATATGTTCTACCATTTAAAATCAAAATAATTTCAACCAGTAATAGTTAATTATTTGGTATGGCTACatcaacttcagcttctgtGCGTCTTGAGCCGA
AGTAGAAACATGTTGCATGAGGTAGTGCATGTAAGTAGCCTCTCACAGACTAATAGAAAACAGGGTAGAGCTGGTCATCGTAGAAGATGCCACAGGCAAC
CGGTGTCGCCGTTTCCCCAGCACTGCAGAATGTCCTCCACTGCGTGAAGAGATCGCCACGTTTATCCAGTGTCTGCAAACCAAAGTGTACACAAGTATTC
GGTCAAGTTTCAAGGTCATTAATTGCGTCTTGATCCCCTCGGCAGGGGTAACGAGTTGCAACAGAGTTCGTCAGCAGGAAAACTAAGAAGTTagtctcct
ccagcttcaggAGTTGGCCTTGCGACGTTTCTACACGCACTTGCGCTGGTCGTTGCGGGGCAGACAATGGTTGACGTTGTTGTAAACACGGCAAGTAAAA
TGGATGCACCCTGCTGTAATAGTCTTCTGGGCCGTCAGCGTTGTCGTTGAACGTGGCTTCAGACACCTTGTCCAGACCGATGAGCAGATCATTCTGCAGG
CTGGCCACACTGACATAGCGTTTGACCTTGAGTCTCCCGCAGAGAAAATGTAGCCGCCTCGAATTCAGAGTTGTTGGCCTCAGTCTCGTGAATTTGAGCG
AGTGCCTTCACCTTGGGTGAACTTCGAATCTCACAAGCACCAGGTTTGCAGTACAGTAGTAAAAGGATAGCCACTTCCAGTCGAAGGGCTGCACCAAGAA
GCTTAATCTTGGAAGGTGAAGCCTCCCATTTATGGCATATCCCGCACGTCGCCTGTAAAAATCTAAATCAATCAAGTGAGCAAACAACACGACTTTAAGA
ACATGCACAAACGGCACGTGGCACCGCACAAGGTGACGCCGGCGAAACTTTATCATTTAGATAAATgcagttcttcctcctgcCCCTTGCATAGCTCCAC
TCCCTGTCGTTTCCTGTCACTGTCTTGTATGCAACTTAGCGACGAGGATCATGGTGGCCCTTCATCATGCGAATGACGTGGAAGTTGAGCGTAGAGCGGT
GCTCCGCAGCGCGGCGCTGCCTCTTGGCCTCTAGAACCAGCGTCATGCCTCTTGCCTCGCGCTTGCACTGCGtctcgtcgaagtcgttgcgctccagcgc
gtccaggAACGCGAGCGTCTCGGGCATTCCCTCGGTGCCATCGCGAATGGTACGCAGCGTCATGCGCTTGATGTGCTCCACGTTGATGCCGCGGCcgagc
ttcatcttcggtCTCCGTTCCTTGTAGTGTGTCTGTGGCTGGTGGCTATTGTAGCTGCTAACCTACATCGATTGAACATATGATAATCTAAGAGATCTAC
CATTGGCTATTTCTTTGAAATCTATGACAATCTACAAGGTATGCTATTGGCCATCGAGTGATCGTCATCATTCCGCAACTTGTATCCGAGGGAGGCCATG
GTGACGATGGCCGACCCCGTGGAGGCGTCCAAGTCGCCCAATGACCAGAAGAAGTACCGGTTGCTGACACTACCCAACTCTCTACAGGCACTTCTCATCT
CCACGGCCGAGGTGGCCCATGTAGTGGCCGCTGTGGCCCGTGAGAGCGAGAGCCAGCAGAGCCaacacgacgacgacgacttcagCGGCGAGGACAGCGC
CAGCGACTTcagcgagagcgaagaggacgacgatagcaacttcgacgacagcgaagaggagagcgacgGAGTGCCTAGTCGCAGGGCTGGAGCGTGTCTT
ACTGTGGGCGTGGGAAGCTTCGCAGAGCCCGAAGCACTTCCTGGTCTGGCCCATTACCTGGAGCACATGCTATTCATGGGCAGCCGGAAGTACCCAGACG
AGAACGAGTTTGAGGCCTTTTTGAGCGCCCACGGAGGCTACAGTAATGGAGCTACGGACAATGAAGTGACCAGCTACACATTCGAAGTGGGTCCAGCGCA
TTTAGAGCCGGCTCTCGACATGTTCGCGCACTTTTTCATCTCACCACTGCTGAAGGCTGAAGCTATGGAGAGGGAGCTATCTGCTATCGAATCTGAATTT
AGTCAAGCTACGCAGAATGACCGAATCCGCACGCAGCAAGTGCTGTGCGACGTGTCGCCCGAGAGTCACCCGTACCATCGCTTCAGTTGGGGGAATAAGA
AGAgtctgctggaactgccgGAAAAGACCGGCGTGGATGTCCGCAAGCAGATTCTAGAGTTCTATGAGAAGTACTACTCAGCCAACATCATGAAGCTGGT
AGTCTGTGGTGAAAACACactggacgaactggagcagtGGGTGACCAAGTCGTTCAGCGCTATACCGAACAAACAGGTGGCGGTGCCGTCGTTCGAATCG
GCGGGATCGCCGTTTGGGGCTGTAGGTGCTGGCGCGCCGTTCCTTTGCAAGATTGTGCCCGTCCGAGATATTCACACACTGCATCTTGACTGGATGATCC
CGCCGGTTCTTGGTCAGCACCATCAGAAGCCTGCAGACTACATCGCTAGCCTCCTTGGACATGAAAGTGAAGGATCCGTGCTGTCACATGTAGGTTAACC
GGAGTTCCTAATTGTGAGACTGATATTCACGATGTACGTTTAATGTGtttgcagctgaaggagcgaGGCTGGATCTCTGCGGTGACTGCAGGAGTAACAG
ACACGGATGGCTACGACTGTGGAACCTATGCAGCCAAGTTTGATATCACAATGAAGCTCACTCCGGAGGGCATTTCCCACTGGGAAGAAATTGTACACGC
AGTCTTTGAATATCTGCACATGCTCAAGGTAAATGGCTGCCCGGGGTGGGTGTTTGATGAGCTGGCGGCACTGGCCGACATTTCGTTCCGCTTTCAAGAA
GAGGATAGTGCTGTCGAAAGGTGCGAAGAACTGGGCGAAATTATGCAGGTAAGCACTCATTTTCATGAACTTTATAGCGATATACCCAGTGCGTGAACTA
ACCGCTTCGAATGCGTATAGTCCATTTTTAAGGTCGCACCGGGAGATATCTTGCGCTACGACCTTTTTCAAGGTGCtttcaagaaggagctgactGAGGA
AGTGCTAAGCCACTTGACTGCTGAGTCCGTTTGTGTGTCGATTGTTTCACAAACGTTTGAGGAAATGCCTGAGTTTCAAGCACAGGTAGGAGGAAGCGAA
AGCTGCCGTTGCTATGGACAATCACTCTTCGCAATGAATGTTGCTAACTTGTCATGATTGGTTTAATGTGATTGTAGgcccgtgaagaagaatggTTTCG
CGTCAAGTACTCGCGGGAAAACATTACGGATGCGTCAATTCTTCGATGGAAAAACGCAGGGACTAACCCCAAGCTGCATCTGCCTCGACCAAACCAGTTT
ATTCCTCGAGATTTCTCGCTAGTGGACTCAACAGGCGTTGATGACTTGGTGTGTGAGAAGACGACGTTCGGCAAGCTTTGGTATAAGCCCGATCGCATGT
TTGCTACACCTCGCGCTCACGTTGCCCTTCTGATTCATTTGCCCAATGTGGTGGCCAGTGCAAACAATTGGGCACACACCCAGCTGTATGTGAAGCTTGT
TCGGGACGCGCTCAATGAGTACGCCTACCACGCCAATGTGGCTGAGCTCATGTACTCGCTTCATGTAAAAGAGTCTGGTCTGGAGCTAATCTTTGGTGGA
TTCAACGACaagcttcatcttcttgtcgaagtGGTCGTTGCGGCTGTATTTGGGACCGAAATCAACGAAGCGCGTTTCGAAGTAATGCGAGAAGAGCTGA
TGCGTGAATCAAAGAATGCCATCACGAAGGTGGCGCAGAAAGCTAAGTACCTTCGGTTGCAACTGCTAGAGAAGCGGTCGTTTCCGCTGGAGGAATGTTT
GGACTCGATCGAGGCTGCTACCGTGGAATCACTCAAGAATTTCGTCTCCAACCAGCTGTATGCAGGCAAGGCATGGCTTGCGAGTTTTGCGCATGGAAAT
ATCTCCCATTCAGCAGCGTTGCAGATACTTGCTAACGTGGAATCGCAGCTACAGCGCGTATCTTCACCGCTCCTGTTGCGCGACTTTCCCCGACGCCTTA
TCAATGCCATTCCGCAGACTCCTATGGGTTTTCTACTGAAGGAGCGCAGCGAGAACAAGACTGAGACCAACACGCAAGTCGAGCTCTATTACCAGATCGG
TCCTTTGACTCTACGCAGCTTGGCGTACGCGGACTTGCTGCACCAGTTGATGGAGGAGCCACTGTTTGACACACTCCGCACGAAGCAAGAACTGGGGTAC
GATGTCTCGTGCACCGTTCGCGTAACCAACGGCATTCTGGGCTTTGGTGTGATGGTGCAGTCCTCGTTGTTCGCTGCCGAGTACATTTCCGCGTGTGTGG
ATCGCTTTATGATTGACTTCGAAGAGGCGATTGAAATGATGGCGGATGAGCACTTCCACGACCACATTCAGGCCCAGATTCTTTTGAAACTCGAGCCAGA
CCACAATCTGTTGGAGACCACGCATCACTACTGGTATGAGATCACGTCACGTCGACTTGCGTTCGACATGGATGCTCAGCTTgcgaaggagatggagacg
ctgaccAAGAGCGAGATGGCTCAGCACTACCGTGAGTGGATTCTTCAGAGCCCCAAGAAGTTGATTGTGCATGTGATTGGCCGTGGGAATCCAGCCGAGA
AAGAAGCACACCAAAAGCGCAAGAGTGCCACGAAagctgagctggaggagatgcgTGCTCTCCCCCGACCCATTCGCATCCGCGACTTGTACCTGTTTAA
GGCTGAATTGCCTTCCTATCCTGATCCcatcgacgagatcaacgcGAGTGAGGCAAGAGAAGAGGACAAGCGCCTAGAACTATAGAGCGCCGGTGTGTTT
CAACTGAAAAGAACGTTGTTGTCTGCAGTAACATGCATTTTGCCGTTAGCTGTTTGGCTGAGAGGCGTCGGAGTGTTCCGTTCCACTGGCTGCGACCAGG
TAATCTTCAGTTGATCGACGGGCAGCAGCGCTCAGACATAATATATTCTGTAGACAGTCTTGGCAATTGGCAGCTGGCCGTCGTAGAATGCCGTCTCAAT
TGTGAGCTTGCCACTGGATGGCGATGAAGGAACTATTAGCGAACAAGATGTTTTGTTTACGACAAGTCGTACGTACCTCATCACTTCCGGGTCGAGCATA
TTTTCCGGACCGGCCGATTCAATGGTCTGCTGCCAAGTATTCGTTGATCCCGGAATCACGTAGCCGAAGTTGAAAAGCCATTCTAATGGACAGTGAGAGG
AGACCTTGAGTATCGTCTTAGATACTTTATGAAGAAAGGAAAATAACATGCACCTTCAATGCAGCTCCCATCCAGGAAGACGCGTTGCTCCAGTCGGAAC
TGCGAAATCTCTTCAACTGAGCTGAAGTTGATTTCACGGGACACGGCAGAGCACTTGAGAATGTCCACAGGGATACGCGCTACGTTTGCCATAACATCTA
TCAGTCTCCCAAGATCAACAGGGTCAACCAGTTAGTTTACCTTTCTGCTCGGCACGGTAGACGTCCTCCCCCCATTCGTCCGACTGCCACATCAATCGGC
CCGTGTCGGCGCAACGCATGTTCATGTGGTTACTGCCATCACAATTTACACATGAGAAAGCTAGAATTCAACATTCAGGTTCACTTGGCTTGCTGTCTCA
CATGATAAGCCCCTTGCAGACCGTCTTGGCCCAGGGATTACTGCCGATCTCGATCTTGCCGACGCCCGcatcgtggagctgcttccatTCTCGCTCCACC
TCGAGATCCAACTTGGCCTGGGCAGCGCGAgactcgtcgtccttgaccggtttctcctcgtccttcaaCCGGGACTTCTCGCTCAGCTTGATGTTGCTGA
TCTTGCACcccagctcctcgtcgatGTCAAAACGCTTTGGCTCCATACGTGGTTAGGACGTGAACGAACAAAGggcgagcaggaggaaggGCCGTTATCT
CGAATGGACAGCTCAATGCGACCCTCTGGGAGCTATCCGATGGTGAAACGATGTGCGAAATGCTTCGGTAACTGCTCGAGTGGCACTCACCTACAAAAGC
ATGAGGCGCGCAAGACGCAACGAAGGTGAGTGCTTACGTAGCATTGATGCAGAGTGCAGCGTTTGACTTGATCTTCATTGCAGCTACACTCTCGTACGCT
AAAGACAAGTCCACGATCATCAATGCGGCGGCGTTACAGGTGGATCTTCAATCTTCACTTGCCGCTTGGCTATGAGAAGATTCTACTGACAAATAGGATA
AATTCAAGGATCATTTAGCGCGATCCATTACGCTGGACTTGAAACCTCGAAGAAGACCCCGAGTTCCGCTTAAACGAGTGGGTATTTTCTTCTCGTAAAT
TGTGATTCAAGAGCTGATCACTGCAAACAAGCAGGTTGATAACAACGACTTTCTGCCATCCCGAAGCGTGTCAAGCTCCGAATATCGATGCGTTTGGATC
TGCGAGACTTGCACCTTCGAAAACGAGGACAATCCAGTTTCAGGCGCTAGCGGTTGTGAATCCGATAGATGTTCTGCTTGTGGAACGCAACGTATCACTC
AACTTCGCCCCCGACTAACACTTGCGCAGAAGCGAGGCCTGGTACGTGAAACTAACGCAGTGTTACTGAGTGTGCCTCCTGTAGAGTGGAGCTTTTGACC
TGGTTTTCCTTCGACGTAGGTCACGTGTCCACCGCCGAAGCTTACTCGGGATGAATGGGAACACTGTGAGCAGCAGgcagaagaacgaggagatATCCAA
CACCCGTGCTCTATCTGCCGCGAACCGTTCGGAGTCAAAGAGCAGGTGATACTAAGCTGCTCACACGTGTTCCACCTCGCTTGCATCACGAGCTTCGAAA
GGTATCCATAGAATAGAATAGGATAGGATATCGTTGGCAATGTCACCCACGAGACTGTGCAATGACTAACTAATTGATTTCCTACCCACTCCAAGGTTCT
TGCGAACAAACCAGCGCGTGTGTCCGCTTTGCCGGAAACAAAACTACCAAAAGCGCTGCACCACCGTGGCGTCAGCTTTTCATCGTGAACACAGCGTCAA
AAGACTTCAGGTTCCGATAAGAGATACTGTACTGTATCCTTTTCTGCTTAAAATCATTACTGACGGAAACAATTTCTCCTTGTACAGGCTGCGTTTCGAG
GGTTTGTTGCTAGGCGGCAAGTGGGGACTCTGTGGCAGAAGGTTCGTGACATACTGAGCGCTTTTGTATTGCAACAGCTAATTGATCAATTGTCTCCAGT
TTTACAGCTCCGGCAAAGGTGACCCCATTCGACGCAGACAGTTTTTCGCAAACAGGTACGCGATGTCACTGAGCGACACCGACGCAGCGTTGCAAAAGCT
CATTCTATTTGCTACAGAGTGGGGAAAACGACGGATCGATTGGTGATTGCCATGAGGAAACGAGATGACTCGATTGATGCACTACTTGCTGAATTTGATA
AGTCGCTGACTATGAGTCGCCGTGTGTTCCAGGATCAAGTTCCAGAGACGAACAATGGTAAACGCGTGTTGTGCTGCGTAGATCAATCCACTGCTAACCA
TTTTGACTTCACAGATCCTGCAACCGGAGGCGACGATTGGCTCTTAATCTTCAACAAGGTCTGTCTGTCGTATAGCTCACTACTGCGCACTTGTACTCGT
TGTTGACTACTTCATTCACACAGGCAAAAGCACGAGACGAGCGCGAATGCGCCATCTGCATCAACTCTTTTTGGTAAATCCACGTTGCATTTTCGCAAAA
GCGTCTGTAAACCACTAACGCTTTTCTAAATGCtatactttttttttatgaatTCTATAATAGCTCATCCATGGAAGGTGTTTCTCTCCTCAGTTGTTCA
CATGCTTTCCACGCGCAATGCCTCTCCGCTTTCGAAGACTTCAACATCTACGAAGTCTCGCTGTGTCCAGTCTGTCGCGCTAGCTACCGTTCCCagacat
ggctacatatCTCGAAACTAGCAACCCAATAACCCCAATTTTAACAACTGCATTAAAACTGACGCTTCACTGTACAATTTACCCATTTTTATATTCCGGT
CAGTGCTCAGTCGCCAATTGGCTTTGAATGGAACAAGTGGGGGAGAAAGTTGTCCGCGTATTCGCCCTACCTCGTTCTACCTGTTGCCCCCCTGGCCCCT
CACACACACAACACTCTACTCTACCCGCCCTACGGATTCGTATTTTAAAATAATGGACCTCGACGCTGGCGCTGACGATTTCTTCGCGGCCCTGAACAAC
GGAGCGGCCGAGGACGTTTTCGCAGGCTTCGCAGCCGCCGAGGCGGAATCcaatggagctgcagacgccagtGGACGCCCGTCACTGGACGATGAGCCTC
TTGTCATGGTGGGAAGCTCCTACATTCTGTATTTTTTCTTGATAATTTACTAATTCAGAGCTGTTGACACTCTCCTGCaggtggacaagaagaaggcaga
aGCTAAGAAAGCAGCCAAGAAAGAagcggcagctcgtgctgcagccgctAAAGCTGCCAGACAAAATAACGAGCCAGCGTTGCCGATGGAGGAACGCATC
GTGAACCTGTTAGTGCCGGAGCTCAAGGTGAAcgacgtgatgctgctgatCCGCAAGATGAAGCAGGCTGGCAAGTCGGACGCTGACGAGTTCTCGGAGC
TCGATGCCGAGCAGAAGACAGGTAATGCTGCAGCGTCTATTTAGCTTTGGAGACGAGGTGGTAACGAGTCTGGTGTTGTTTGGTGGTGAAAGCGCCGCGG
TTTCGGTGCGAGACTTGCGGCAACACGGAGCagaacaacttcatcacAGACTACGCTCGCGGGGACACCATTTGCAATGGTCTGGACGGGAATGGATGCG
GTACGGTGGTGCAGGACCACATTGTGCACGAAGGTAGCGCCTACCGTAAGttcgaaggtgaagaggacaagTCGCACCATGGCCCAGCGCCCAACAAGTT
GTTCTCGACTGGGCACAACTTGCGAACGCTGATTTCGCAGGTAATTGGGGCTGGTGGAGGGGGATATGCAAGTAAAAGCGAGTATTTACGAGTACTTCTG
TGATCTAGGATGGCGAGATGGCTGGGAACTTGAGACGCGCTGCAGAGTTCGTGGAGATGAACCTTAGTCAGATGGGTAAGGATGAACGAAGGACACGTAT
TGGTTACAAGGACCAGGTACGATTGGTCTCGCTCATTTGCCTTGCGAGGTTTCCGTTCCAAGCCTACTCACGTGGATGGCGTCGTTTGTAGATGAAACAA
AAAGCCTGTCGCTTGATTGACCACACGATCAGCAATTTAGATCTCCACGAAATCGTGGGCAGTCGCGCTAAGAAAATGTTTGCCGAGTTCCGTGACGTCC
GGGAGCACGTGCATCAGTTTGATGCTATGGTGGCAGGCTGTGTGATTGCAGCGTACCTGGAAACGAGCAAAGAGATGTACTCGGCACAAAATGGCGTTCG
TATCGGTCAAAGCAAGCAGGCAGGTATTGCCAGCTTAGCTCTGGCGCCGAACAAGGCTGTGGATGAGAAGAAACTGCATCCTTTTACGTGCCCGCTGTGT
GATATGAAGTTTAATGCGCGGCGCGGAATGCAGTTCCACAAGTGCGCTGGCAAGCCTGATGAGGACAAAGAGAAGTCCCGAACCAATGCAAATCTGGCTC
CTGTGGTGTTGCCCGATCAGCTGCAGCCTATcatcgagatgaagaacggcAAGCAGTGGTTCAAGTGCCCGGTATGCTCACGAGTGTACGGGAAAGAAGA
GAGCTTGTCGGAGCACATGGTCCGGCACAAGAaccagagcaagaagcgcaaacacCACATAGAGACCAGCACGATCGACTCGACGCGTCTCGCTAAGACC
ACCAAGCTGGCGTCTGCGAACCCTTCCGTGCAGGTGAACACGCATGAGCAGGTCATGTTCCGCGGCGAAGGTCGACGGGTTTGGCTTCAGCATCTCACAG
AATAGCAAGCTATCCAGAAGCTAGAGCCCCACGCCAGCATATACCTAGCAGGTTGAACAAATACGCCATCGAAGCAAATTAATGTGAGGTGCCATGAATT
GCATTGAACCACTGCAGCTCACTGCTACAACCTCGTCTATTCCTCGTGTTTGCTGCCTAGAATGTCATTCTCCGTGAGTTCCAGTACGTCCTCGCCCGTA
ACGAAACGGACCTTCTCGCCCTTGTCCTTCAGCAGACTCTCCACGTCTGTACCGTCATCCTCAAACCAGCCCAAACGGTCGGCAATGAGGTGGAGGTTCT
CACAGCCAGGGCAACGCACGAGCACCACGCCCTTGTAGTAGGCGTGTTTGCTGATGGTCTTGGCCGAGCGCGTCTCGCACACGCTGCACGTGTAGAGCAT
GACGAACTTCTCTCCGGGGCTTTCGACGCCAGGTGCACCCGTAGTAGCAGCGTCCGTAGACTCGGTGGAATGCAACGGTGTGTCATTCTCATCTTCGGGT
TTCGAGGTGAAGCAGCGGCACTGGCTGTGGACGTGCGGGGACGCAACGCTTGAAGCTCGCAGTAGTGCCAAAGGGTTGGCGGTGCATATCCGGCGCAGAT
GTTGggacgacagcgactggGACGAAGCACGAGAGCGCAGCGCTGGCGCGCAACGGACGAGAGCTCGACGCCACATGATCAAGTAGAATACTACTGGAAA
GTTTACCAGTAACTTTTGCTACCTGGTAGCACCTTGATTTAaagttcgaggagctcatcTAGAACTTTATGTGTATCCATCTGGAAGTCGGATTATGAAA
AAGATACCTTCTATGcggttcttgctgctgttggcgttgtgcgtggagctggcagACGCGCTCATCAGTTTGGCGTCTGTGACACCAGCACCGCTACATG
CAGGCGTCACTGGGACGGTGAATGTGGCGTTCACGACGAGCATCGACGTCCCAGTTGGCGGGACGATTGTGGTGACGTTCCCCTCCACTTTCTATGTGGA
TTCTGCCTCGGCACTTTCCAATCCTGTGGGTTTTGACTCAACCAGCACCATTTCAACAACATCAGCTACTGGAGTGGTGACGATCACCATTGCCACGACG
GATGCTGTAGCTGGAGCCATCTCCTTCAGGTTGGATAGCATCTCGTATCCAGGTTGAAATGATTTTACAGTATCAATTTATTGTTGTAAAGACTTACACC
GGTAGGCTGATTGCTTGTAGGTTTGGGCACAACTTCCAGCTACTCGATTCGAACGAAGAATGCGGGTGGTTCGACGCTCGAGTCGACTACAGTATTAGGA
TCCTCGTTCAACTCGTGGTCCATGATCACTGCTGCAACGGTGACGACTGCTTCTGCCATCGCCGGCACAACAACATCGTACAGAATAGGCTTCACGACTG
ATGTCAAACTGCGTATTGGGAGCGTAATTGCGTTGAAAGTTCCAATACTCACCGACAGCGTGATCGTCTTCAATGGTGCTACCCTTGGAGCTTTGGTTGG
CATTGACCCCGCCTCGACTGTGTTGCGAGTGGTTTCGCCATATATTTTCCTAACAATTGCTGGTCAAGACATCGCGGCTGGATCAGCCGTGCAGATCACG
TACAACAACATCAtcaacgctgcagcacaacaaACACCAGCGTTTTACGTGGACACACGACATCCGAACGGTGCCATTTTTCAGGTTGGAGTTACGACGA
ATGGACTTACTTTCACGAGCACTACACTCCCATCAGCGACGTTAACCCCCGCGTCCTTCTGGGCTGGAGTTACGACGAGTTACAACGTTGTATTCGCAAA
CTCGGCCTACCTGTCATCGGGAAGCCGAGTGGACATTACTTTTCCAGCTACCTTTGACATTAGTGGCATAAGTTTGACCCGTACCACAAATTTGCCCACT
GTGAACACCGTTTTATCGGTACTAAGCGCAACTACAGCCAGAGTAACACTGGGAAACGTTGCTGTACAGCCTGGAACCGGCCGCGGATTTACCCTGGAGA
ACATAGTAAACCCTGGATCTACCTGTGATGAATATATTGTGGAGTATTGTGCTGTGGGGAGTCCGTACGCAATCTCCATCAGCGACAGCGCTGGGAATGC
ATTCGAAGTGTTATCAACAGTAATGGGGACGCCCATTGTGAAGAAGCCACTTACATATGGTCGTGTACGTCCATTGCTCAAGTCTCCGAACACACTCACG
GTTGCGacggtgacgctggacacTGCGACGAATATCCCTCTCGGTGGCTTTATTGAGGCAGTTTTTCCTACTGGTTACAGTATTGGGTCTGGTACGATCA
CGGCTAGTGCCTTGATAAGCATCCCCAGTGCTAGTACTGCTGTCACCTCCACGTTGAATTCGGTCAAGTTATGGATTGCAGGTGGGAATattccagcaac
ttctggAATTTCATTCACGGTCGACAAGATCACTACACCGCCAAACTCGGCGGTGGGGATTTTTATCGTTCgtactggagacgcaggaggGAATATTATC
GAAGAAGGCAACACTATCGGTGGTGAAGGGTGCACGTACGTGAACGACTGCAGTGGACATGGGACTTGCACTCTACTATCGAAGGTTTGTATATGCAACA
CTGGCTGGGGCTCACCAACCGACGTGGCGGACTACAAGTCCCCAGACTGCTCTACCCGTAAGTATTGCACTGCTAGGTATCGCGGGGGTTTCTAACGACG
TTCGTTGAAGCCAGGTGTATGTCCATCGGACTTTGCATGGAACTCCATCCCCACAAGCACCACTACAGCCCATGATATCCTGGTCGAGTGCTCTGGAATG
GGCGAATGTGAtcgaagtgctggaacttgCTCGTGCTTTCCTGGTTTTGAGGGGGCTGCGTGCGAAAGGAGTACgcttttcttccagttgTTTTATGCTG
ATCATTCGTGTTCATATTTGCTTGTTGCATGAGCAGTGAGTTGTCCAAACGATTGCTCGAATCGAGGCGTCTGCATGAGCATGCGTGAAAtggctgctgc
caagaacGCGCTGCCCATTTCTCCCCCAACAACCTACGGAAGCGATCTGGTACGTCCATTTTTCAAAGGCTCCTCATGGAATTTATCCAGTCATTTTTAC
CGCTTCTCGCAGTTCTCCAACACCTGGGACGCCGATAGGATTTTCGGATGCGTGTGTGACTCCGGTTGGGCTGTTGGGACGGCGATTGATGAAGTACAAG
CCACTGAGTACTTTGGCGCGGATTGCTCGAAACGTACGCTTCATCCCGGCTCAAAGCCTGAGCTTTAGCTTAACTAACTGCTTCAAGTTGCAGGACACTG
CCCCATTGGAAATGACCCTGGTACAACTGCAGACGAAACCAACTGCGTGGGGAAGACTGTACCGGGAGGCACTGCAGTAGGCGCTACTGGGAATAAATGC
CTGGTCGAATGCTCAAACCGGGGCGTGTGCAACTACAAAAATGGCATCTGCTCCTGCTTTCAAGGATATACGGGATACGCCTGTCAAACACAAGACAGCC
TCGCCAAGTAGAGGAAGGGAGTTCGCATTACCGATAGGCATCGCTGTCCAGCTTGCTGTGTGTTTAAATAAGTATGACTGGCTGCAATGTCCTGCTCGCT
TCCTGCCTCCGTTCTAAGGAATCGCGGTGTCGACCGATAGTCAAAAAGTCGGCCGATCGTAAAATTTGGCAGCACCGAGTTATTCCATCTGAAGCAgtag
ctccttctcgtccagagcTTTCTTCGTGCTGATGTCGCAAATGTAGACCTTCGACTTGCGCTTCAAGtcgatcttggccagcttGGACGGAGGGAGGTCG
TTCACCGTAGCCTCCACGAAGCCACGCTCCAGGAACCAGTGGGCCGTTCGCGTCGTCATTACGAACAACTTGGTCACGCCCATAGCTGCAGCCTTGCGCA
TAATGTATCCCAGCATTGCATTCCCCTTGCCAAGGTTACGGTACGTCGGGTCCACGGCCACGCAGCCCATCTCGGCAAAGTTGTTCTCATACGGCTGCAG
CGTGCAGCAAGCGATGATCGCTCCATCGCGCTCCACGACCGTAAAAGTATCCACATTGCTCTCAATCTGTTCCTGGTCACGCgacaccagcacgtcgtcg
tccagcagcggctgaaTGAGGCGCATGACGCTCACAATGTCGTTAGTCGTGGCCATGCGGATCCCTTCGTACATGTGCTTGGTGATCATAAGACCTTCAC
CGTCGCGGGTAAAGAGCTCCTGCAGTAATCCTCCATCCACGTGTCGACTCACAAGGTGGGAACGCTTGACGCCGTTAACACAAGCCTTGATGGATTCCTT
CAGGTACAAGAGGAAATCACCGCTAATGTCCGGATTCTggcgcgccagctccacaTACTGCTGAGCCTGTTCAATGACTAGAGTCTGCACCACCGAGTTG
GATCGCGAGTCGATCAGCTCCTCTCCATTGTGCATGAAGATGAGCTTGGCGCTATCCAACTGAATCGCACATTTGCTGGCCACCTGTTCCGAGAGGCAGT
TGAAAACCTCCCCACTTGCACTGTAGCCGATACTGGAAATGAGGACGATGTCTCCATCATCCAGCGCTGCCCGCACCTTGTCCACATTAAGTCGTCGCAT
TTCGCCAGTGTTTTTGAAGTCCACACCGCCTCGAACTCCAACGGGTTGCGCTGTAATGAAGTTGCCTGAGGCAATGTTGATGGTCCTGGCACGTCCGGGC
GAGTTGACGATCCCTCGGCCGAGGTAACTCTCGATCTGGAAGCGCACCGAACCTGCTGCGTCCATTGCACACTGGAGCTCCATGGGTCCCGTGATGCGCA
TGCCGCAGTCGAACCTCTGCGAGAGCTTGCGGAGCGACAGTTGCCTGTTCAACTGCGGTCGAGAGccagccaccagcaccagcttgaCGCCGAACGTGTT
GAGCAGCGCAATGTCGTGCATCACAGCTCCGAAGAGGTTGGACTCGACCAATTGGCCTGGCAAGTGGATGACCATGGTAGTGCCTCGGTGGAAATTGATG
TAGGGCGACATGTCTCGGAACATGGCGGTGAAAGAGGACGGTCCCACGGTGGTAGCGCGGCCCTCAGCTTGCAGAGCCTGCTGCACACGCAGACACTCTG
GGGGTACAATGGGCATGAAGTCGGAATAAGGTCCCTGGTTGTCGTCAGTAGGAGGTTCGAGACCCACGGGTCCGAAGCCATGACCATGCCCGTGCCCGTG
TCCGCCTCCAAGCGACTCACTCAAAGGCGCAGAGGGCGTGGCAGCCTGCAGAGCGCCGCGGGAGGACGTGAAGACGCGCAGACTGCCCAGAGACGAGCGC
GAGCGACCGCagacggacgagaagagcaaTCTGCGCGAGTTCAGGACGCCGGGACGGACCCACATGGAGCTTGGGCGGCGGGGGCTTGGTCAGCAGGGCG
GGAGGGGCTTGAGCGCGGCCTGGCGAGTGAGAAAGTGGACGGCGGAGGCACATcattgagcagctcctgtgGTGGTTGGCAAAAACCACCCGCGACTTGC
TCTTTTTTTGCTGGCAATGGATGACGCAGAGCTTGACACGCATGCAATATAGGAGGGATATGTTGGAGGATAGGACACTGTAAGTTGGTGGAGCGAAAAC
TGAAGATATACTGTGAAAGTTTATGTGCTAAGGGAGTGTTGAAGACTCGTTACATAGGTACAGACATCCGTTTCTGGCACGATCCACAGCACTGCGCGAG
CTTTTTATTGTGGTGCGTAGcgcttcgagtcgaagctgtcgcgAGTTCAAGGCAggtggaaggagctgccaCTGTAGGAGTACTGTGGAGAGCGCATACA
ATGAATGAAAAGAAAACATTTGCTGCATTCGACTTCGAGGTTACTGCGAAAATGTTAAACCGGCTACTTCAGTTTCCAGGTTCAGTTTCCAGGTTGCCGT
TGGCCGCTTGTCCATGCCAATCACGTTCACCTACCTGCCATTCGAGGCTGTTACGCGTCCTGTATCCTCAGCGCGTTACTTTCCCTAACTTTGTAATACT
TCTTCGgtgttgaagctgcatccCATTCCACCTAAGCTCAGCTTTGAAATTCCGTACTCATTCTGCATCCCATGCCAGTGCTTGAGCTGCGGTGAATGCC
TGCAAAGGCTTCTGGCACCCAAACGAActgcgacgcagcagctttttCTACAACTTAAACAAAGCGTACGGAATGTACATCCCACGCGAAtgatttaaaa
aaaataaagtATCTTTCTGATGCTGGTCTGTACAAAACTATGATCTAGCGTTTAGTGGGATTAGTCTTTTCCGGTGGCATAACAACTTACGTACGTTGAT
TGGTCATTAATGTGATACAACTGTATATCATCGCACCAGCTGCAACTGACGTGGGTGCACAGTGCACACGTACGATATCCTGGTGGACGGAGTGCAATTC
ATTCCTCGATCGCCCGCCGACCCCCGACGCCTTGATCTCCATCCTCCCAATGGCCAGCGCTGCCCCAACATGTTCGTATTTTACTGAAATTGCAGCACCA
AGTTGCCACCCTCTAACAGTCCACCGTTTATGACAGTCGCAGAGCTCAAGAGCCTGTCCGCCGCGTGTAACAAGCTCTGGGAGCTGGACACCAACcgact
ggaagctggcgTTCATTACGAACTGAATCTGCAGGAAGGAAAGACCGCCTATGCCCGCGGTGACGCTGCGCATGACCCTCTCTTCACCTTCGTAGACCCG
AGCGTCTTCGAGCGCCGCACgttcaagctgctcttcgacCTGCTGGACAACTACGAGCGCGAGGTTGGACGCTGGCCAGCAAATGCAATTGGGTGGAGCA
GCGTTTACTGATACTGTTCGGGTTGtgtctctgctgctgttcagACGGGAGTGACGGAGCGGGTGACGCCGCAAGAGTTGGCGGAGAACAATGCCTTCCT
GAATGCGGTGATCGAGACTGCTCCTATGCGCTATGCCCACGCGTGCGTATtctgttgtgctgctgagAGTTTGTATATTTACTTAACTAATTATGGGCAA
TTCGCAGTTGGCTGGTGAAGAACAAAAAGTTCACAGGGGACATGCAGGACTTTaagaagaaactcgagtTCATCTGGTTCGGACTGTACCGCCGCGAAGT
GCGCAACGATTCGTCGGGCTTCGAGCACGTATTTGtgggcgaggagaagaacgtgaGGCCACACACCGCATTAGATGCTACGACGACGATACGTTTTACT
AACGGATTCGTGAATTTTGGTTCAGGGCAAGATCTGTGGCTGCCACAATTGGCTTCAGGTGTACAATGAGGAGCGCAATGGCCGCATCGACTACCGAGGC
TACATTCGTCCCAGACAGCGCGGATGCAAGTTCATGGAGCCCCACAGCAAGGAGCAGCTGATTActttccagttccagtgggAAGACGAGATGAAGCCTG
TGTCCACGAGGTAAGACTCCAACATATTGCCCCAAACCAGGTGATTTCTAACCAAAATTCggtttgctgcagcttgatcGGAGTGAGCCCGGAGTTCGAA
ATGGCTTTATACAGCATGTGCTTCCTCAACGGCCAGGAGAACAaccacgtccagcttggGCCGTACCTGTGCAACGTCAAGTGCTTCACGTTCGGCCGCG
GCAAGGACACCAAGATCGGAACGGCCTTCCCGGAGGCTCTGCCACTCTCAGATGCGCAGGCTGCAACGAAGATCCAAGCTATTCTACGCGGCCGCCACAC
TCGCGTGCAGAATCCTCACGTTCGTCGCCACCAGGCTCCGCCCCCTCCTCCTGGTGCCGCGTGGGGTCCCCCGCCTGGAGGTGCAGCCACCCCGGCCCCA
CAGCCTACCCGTTCGACTGGAAATGCATGGGCTAAGCCACTGACTCAGCCTGTTGCCCAGGCACCCGCTGCCCCTGCCCCAGCAGGCCCAAAGCCGACTG
GAGCGTGGGCTCAGCCGCACAAGTGGTAGCTTCACAGTGCGTGGTTCATTGCAGACACAATGTAGATAATCAGCTTTTCCTGCTTCTTACATCCGTTTCG
TGGCTGTGTTGATATGCTACAAGGTGCTTCCTGAATTAGGACACGTCTCTGATGGTTTCACaaccgaagctgcttgatcttcgAGCGCCCCTCCATTCTC
TGTAGTGACGGCCACAGTAGAAGCAGCCAAGCTAAAGCCGCAGCAATGGAAGCCAAAGGCTCGGGCGACCGTAGTGAGAACACGCACAAGTCGTCCAAGG
GCCGACCAGATGAAGTCGACCTCAATACGGACGAGTCGGGAGCCCCCACCCCCGAAGTGGTGGCCTTACGACACGGATACAACCAGACGTACATCGTCCG
GTCCAGCAAGAACAACCTCCATGAAGTTCTCTTCCGCTGCGGCAATTGGTGCTACAGTGGTAAAGTCGACTTGGGCAGTGCCGATCTGGAGCTCGCCGAT
CTCCCGGTCGTCGTTCCTGCActacagaagcagcaagcgtCGTTGCAATATCTTTGTGAGTGGAAGGCGATGCCCTCGACGTCGCAGTACTCGTCACCCC
TCGAGACTTTATACGACGTTTATGACTTCATCGGTGCTGAGCTTTCCAGTGAACGGATTGAGCGTAAATTGATGAAGGCAGCGGGAGATCACGCGTGGGT
GGACGGTGATGATgacggcagctccaagacgttcttcgagctgcagagtGGCGGCTACGAATGCTTCGACGGCGTGGACATCGTGGCCAGCAAGACCTTC
GTCCGTGGCCTGGTGCTTCTGGTCATTTACTACCAACGAAGTTTCTACGTTGTTCTGCAGGCGGCAGACGGAGAGCAGCCTCTGCTGGATGTGCGCTTTC
CCGATCTCTCAGCTCACCTGCAGGGCATCCATTTGCAGAGCTACCGAGAAGACGACTGCAGTAATATGAAGAAACTCACTCTGTGGCAGGCGGCGAATGC
TGGCAAGCACCAAAGCCCCCCGAAGCCATTGAAGGTGCAGTGCAAAGATGTTAGTGGCACAGGCTACAACCAAACGTTCCTCATCCGCCGCACACCCCGT
ACGGAAGGATCGACAAACACTCCGAGTCTGCGCGAAGTTCTGTTTCGATTTGGCAACTGGTGCTACAATGGACACGTCGATCTCGGGCCGAAACTCGAGT
TGTCGGACATTCCCATCATCATCCCCATGCTCCGTCGACAGCAGAGTGCTCTGGTAATGTCCAAATTATTCGCCGTTTACTCACTAGCACGATATCTTAC
CGTTATTGCGCAATTTCCCAGACTTTCATGTGCGAAGTTTCCAAGATGCCGGCGACTTCCCTCTTCACTCCGTCGATGGAGCACTTGGCCGAAATTGTGC
CTGCCATGCAGGAGGAAATGTCCAAGGCAGAGCAATTCGTGCAGACGTTGGCTCAGACTGGTGGCTCCTTCGTCAAGAGCAAGGGGGACGTTGGGAGCTG
GCTGGAAGATGACAACATCGAGTGTTTTTTCGAAATTGCCATGGCTAAATGTGCCGCTTTCCAGGTTAGTACACCTTTTTTTTCGATTAGTGATAATATT
ATCACTAACTTTTTTTTACAACAGGATGTTGAGGCAATTGCCAGCAAGATCCACGTTGGAGGAGTGGTTCTCGTACTGCTTTACTACGACTACACGTTCT
ACGTCTACCTCGAGAGcggcgaggaagagcaacCTCTACTGGATACCAACTTCCCAGACGTATCGCTGCAAAAGGAGGGGGTTCAGCTCAAAACTTACCG
CAACGGAGTTTCCGGTTGCGAGGAGCTGCGACGTATCAGTCTCTGGAAGGTCGAAAACGACTtcgccgaagacgaagacgaggaggaggacgctgcagct
gtcgACTGCATCACTTCACACAGCAAGGGCCAGTTTCGAGCCGATTCCAAGGAGGAACGCAGACGTGAGGAAGATGTCAAGTCGCCAACAGATTCAGACG
CCAAGGCGAAAGACATGCAGTCGCGCAAGTCCGCCTTGCCCCATCATATTGCACCCCTTAAGCGTCCCAGTGCTGCCGCTACCAACCTCAAGGGAATGCC
CGACACCGGTATGAAAGCCCCATGGGATGACACCGGAAAACCACTTGGAATGCGAGCCAGCAAGTAACCAAGAGCATCGGATCGTTAACCACCTCGGTGA
CAGTCAAATACATCCCCGAATTCTTTATAGTGCAGCAATTTCAGCAATACGAAATACACTCAGCATTCAAATCCACCCGCCACTGCACTATCTTTAAAAT
TCCTCTTCGGCGACAGTGAGCCAGTCAGGGATATTGGTGCCTTTGGAACTCGAGTAGTCTTGGGACGAAATAGCTGACACACGTGCACTATCAGTTGCGG
CATAAATTGACCCACCCACCCACGCTAGCATGTTCCGAGGGAAGTACGTCTGAACGAGCTGTGCCCGACCAACAGCCTcggaagcagaagcgaaCTCGTT
GTCGTGGCGAAGTGCCTCACGAACTTCAGCTACCACTCGTTGGGCGAGCCCTGGAAACACAGTCACCTTAGCACAATATCCATACAAAGCACAGGTCTTC
GCGTTAAACGTACCAGGAATCATTGCGGTTCCCCCCACCAGCAGTAAATTTTCCAGCATGGCCGCTCTGATGTCGACTGGGGCCTTCTTTAAGACATGGG
TGATACCGTCGACAATGGACGTGCCATCCGTACTGTCGTCTCCTACAGCCATAAAGGGGATGACTTAGCCATGAATTTGAAGTAAAGGCTGTCCATCTAG
CACAGCTTACCAATGAGTAGTTGTTCCACCGCAGCAGTGCGTAGATTTCCAGAAACCTGCCAAGTAACGGAATATTAGGCTCGTCATTGATACTTAGAAA
TAGTATCCTTTGTCCAACCCGCAGGATATCGTTGCCTTGTGTCTGGAACTCAGCATCAACTACGTTCGGAAACGGATCCTTCATCATCACAAAGTGTCAA
ACTTAGAGCAGTTGCATAGTCTAACCAGCCCATAACGTCTTACCTTTTGCTGCGCAAAACATGCTCGTTCCAGGATATCTTCTGCCATCGCCTCTGTCAT
AGGCGTGGCAAGCTTGGAGCCGTCCATTGGTTGATCGCGAGAAGCATCCAGCTCTCGCTTAATAACCTCACAGCAGTCCCGACTTCCAACAGACACCGCT
ACAACAGGTAACCAGGGTGTATTTAGTTCCACACGCATCTGTCAtttgagcagcaacacaaTGTAAACTCACTTTCATAAACATAAGGCAGAGGGATACC
CTTGAACACAGGTAGCAATCTCGTCTCTGCCCATCCACagtccaccaccagcgccgtgTGGTTGGCAGTAGCATACAGCACCGCCACCATCGCAGGAACC
ATTGTCACTGCCGACGCCTAACAGGTACCAACATCTCTACATTCAGCTCTTAACAATTCCAGCATCAACTCTTACAATTAATTACCTTGAGTACGTCAAA
CAGGATGTTGAGCAGCGACTCTCGGAACACTCGAGGTAGCAGAAGATCTTCACAAACCACAAAACGCCGGCGCGTCGGATTCACCAGCAGTAAACTGCCA
CTCCCATCAAAATCAGCCGCCCGCAAAAGCACTATCAGTCCAAAGCATAACTACTTACTCGAAACACAAAGCGTGCAGCTTTGGATACAGATATTGGCGC
CATTCAGCGGCACTCAGTGGCTTCTGTAGCATATCCCCCACCTGAACAGTACATTAAATCAGTACATTTGCCATGCTGAGCTGCCACAACGAAAACCTCA
CCTGCCAGCGCTCCACGCATCGAGGCGCGCGCTCCCCGGAGATGCCACAGCGGGCGTAACGCGCTCCCAGATCAAGCACCAGCGCGCTCTTGTCGCTTAG
AGAGCTGCTCATGGAAAATTACCTCATGATAGTGCCTCTGTGAACTTTGAAGAAAAAACATTACAATTCACTTTAGTGACTCTCGAAAAGTTtatggaga
agctccagttgaAGAGAAGCTCGCGTATGGCGGAcgttctgctggtgctcatCGTGGTCTCGCAGGTGGCGCTGTATCTGCTTATCGGATACCTGTTCCG
CACACTGAGCCGCAAGCACCGCGACCGCAACACTAGCGACTTGCAGCGGGCGCTGATCACCAGGCAGGCGAATGGCACTCTTTCGTGTCAGAGTTCACTT
GGGTTTGACCTCGGAGTTGCTTTGTATTCCACAGGGAGGAGGCGACTGGAGAACACCGTATCGATGTTGCGACACTGTACGTACAGTGGTTGGATATTGT
CCTATGCACACACAGAACAATTGACTGGTAGTTTTGgattactacatgtagagacgcggaggaggaagtcgtGCGGTGTCGAGTGTGTGCGTTTGCAAAC
ACGCAGCGGTTCAGGTTCTGTGTAATTTGCGGCGAAAAGCTCAAGCTGTCGCCGACAGAGAGGGCACGAGCGAGGAGCCCCCTAACCGCTCGACAAGTGC
GCGTAAGGTAAGTTGGTTCTTTTCATGGTTGAGTtgcattttgttttactttgTTACGCGGCGGTTTATCAGACGTCGGACAGAATGGCAGCGGCAGATC
AAATGTGGAGTGATTTCTTGGCATCGAAAACTTGATCAAGAGTGTTTCCAGTACCCAGGTTACGTGGTAAGATTTCGTGAAaaagaagacggagatgatG
AAGCAACAGAAACCAAAGTGGCTGTGGTTGTACCGGATGGAGAGCCTGGATCAATCATTACGAAGCTGCAAAATGATACAAGGTTGATGAGGCTTGAAGC
TGTGCCTGTTGAATATGCAAACGGGCTCGGGTTCGCGACAGGATCTCCCTCGCCAAGGAGCGATGATGTTGAAGGCCTGGTAGCTTTGTCTAAAAAAGAC
TTTCCGACCAAAATTGCGCATTTTGTATCGTGCACCTCACCTCTGATTGTCCCCGCtgcgctggaagtgctgaagtTGTTTTTACGTCGTGAATACGTTG
TCGAAGAGTCAATGGAGTATTTTTGCTGTATGGATGATAATGATACCCGTTCACTGGTGCGAATAGATTTTGCGTCTGAGAATGGAATTGACGCTGGAGG
TGTGCATCGCGAATGGTTCTCTCTCATCACGGAGCTGGTTATCGATGGATCACTGGGCATCTTTACATGTACAAACCACGAGGCCCAGACGTATTTCTTC
AATGCGAATTCGAGGCAGTCTCTTGGCGACGAGCATCTAGCGTACTATTTTGCTGTTGGGCGGCTTGTCGGTCGCGCGCTTCTAGAGGGTGAAGTCATGG
GGTTTCACTTTGTGCCAGCACTACTGAAAATTATCCTCGGGATTCCAATTACTTTCCATGACTATGAGAGTTTCGATCCAGTGACGTACAAGAGTTTGCT
GTGGATGCTTGAGCACGACGGTGCGGACAAACTTGGATTGGATTTTACAGCCGCAAGGAGAGATGCAAACGACAAATTGGTGACAATCGAGCTTGTTCCA
AGCGGTGGGGATATTCCCGTgaacgacgacaacaagCACGCCTTCGCAGAGCGCTGGTTGCACTACTTCCTGTTGGAAAGCGTGTCAGACCAGCTGTACG
TATTTCTGAAAGGCCTGTACCAAGTGATTCCGAGGCAGACCCTCATACTTTTCGACGCGGAAGAGTTTGACTACGTGTTGTGTGGCAGCGACTCGATCGA
TGTTACGGATTGGGAAGCGCACACCAAATGTTCCAAGAATCTCACGGGAACACGAGTCCTTCGCTGGTTCTGGGGGTTTGTTCGGGACATGAACGTGGAG
TGCCGACGTcggttgctgcagtttgcaACAGGATGCTCACGGGTACCGATCGGGGGCTTCCGGCACCTGACAAGCCACGACGGGCAGATCTGCCCGTTCA
CGCTGAAGGGGGTTCACTCGCCTTACATCCGAAGCCACGCGTGCTTCAACAGATTGGACCTGCCGTTGACATCGTCTCGAaaggagctccaagaagtGCT
GTACGCCACTGTCAACACGGAGAGGTACGGGTTTACGACAGCCTAGAGTAATACTATGTATAAGCCAAGTATCCTGGAAGTCATTGCCGTGATCTTTCTT
AGTGCACTTCTTGAGGTAGGAAAACACAGCTCCGTCGGAACAATTTCCTGCAACTTTAAGAACCCAGTGACCGAGCAACGGGGTATCTGACGAGGACTCC
AATGTTACGACATCAAAGAAGCTGTCGAAACCTGTAAGCTTACCGGatactgcagcagctcttcattgATAATGCTGTGGAGCGCCATAAAATTTGCTCG
ATGAAGCAAAAAGAACAGTTCTCTCTCGCACGATCGTAAACCAAGGAAGTGCCGATCGAGCCGTCATCTTGCAAGCCGTGTACGCTGCGAAGGGGGTGTA
GGTAGACAATGTCACACACCTCGCAGCCGGGTGGACGATTTATCACTGTTGAAGGCAAAGGTTTCAATTCATATTTATCCACGGTGTGGTGTATCTTCGG
AAAGTTGACATTGAGCTCTTCACTGGCAACGTATTATACTGTAGTTTGGTTTTGTGCATGGCCGGCAGGTCTGCAAGCGAACACGCTGTTCAAACCTTAG
AACTGTCAAGGCAAAAAACAGCTTTGAAACAGgctgcagtacatgtagcagcaTGTAGCAGTGCTGCAGTCTATGGGTAGGCTGTTGCCGTAGGTAACTT
GCATCTGTGGGCAAATGTCGCTTCCAAAACCGTGATCTTAACCCTCACTTTACTGCCTATACTCAGCATCAGTTCCTATGCGAGTGGATTGTCATTCTTG
CGGGGATTAAAAGAAGGCGTAATCCCCATCCGAGTGAATCTGGCGCAAAGACGGAACGCCCTCACCATACTGAAACGCAGTCACGCCGGCTCTAGATCCC
CTTTGAAGTAACCGTGACGGTCATTCCGCGACTTGTGTCTGACCGACGTATTCCACTTTTCGCCGCAGTTTAGCTCAACCTCAAGGACCCCCTTGGACAC
GGCCAGCATGGACGACGATCGCACCACGGAGGCGTCCATGCTGTACCAGGGCATCggcatgctgctgctgtgcgtcatcttcttcgtggtgtGGCTCATG
GCCTGTCGACGTAATCGCCACCTGCTCGACATGGAAGTCCCTTTGCTCTCGGGCGAGTCCGTCGACCATCGAATAGATGCCGCCACGCGAGAAGCAGAGG
CTGGGTATACAGTCTGCGCTAGCTgcgagttcgagaacttcaagcgcttcgagtACTGCGTGCTGTGCGGGGACAAGCTGCCGTCTCTGTCCATCGTGAC
ggcggacgacgagagtgacgacgaagagcaacagcaccaTCATCACCTGCAGAGAGCAGAGAGCAATGATGGAGCTGTGAATATTGTGATACAACCGGCG
CACTCAGTGTCGCCGAGACCGAGGAAAATGTCGTCGTTGAGTCGTCAGCAGCGACGCGCCAGAAACCGTCGAGAGTGGAGCCGGAAACTAGATGTGGAAG
GGAACCTCTTCTGGTACCGCAGTGGGGGAGGCAACGTGCCGGTGAGCAGTGAGGTGGACGCGCTCATGCCTGGCTACACGGTGAGTTTCAAGTTCCCAGA
GGAAAAGGAGTCAGAacaagagcaggagacgctTGAGAGCCAAGCTGAGGATGAAGGACAGGAAACTGAGCCCGTGCTCGCAGTGGAGCAGCCACaggaa
gccaaggaagaTGTTGAAAACAAGGCGATATTGCCCACGGGcgtgaaggtggagctgaTTGAAGCGTCAGCTTCCGACCCGGCGGAATTCCCCACCGGTA
AGTCAGTGCTGGCTGATGCTGGGCCGGAGCGACGCAAGGAGACTGTGTCTTTGGCCGCTAGTGACTTCCCGTCCAAGTACGCGCACTTTGTAGTCAGCAC
TGCCTCGCTCATTGTGCCTGCGGAAGTGgagttcttgaagctgtcggtgCACCGAGACTACATGATGGAAGAGTCGATGGACCACATGTACTGCATCCAG
CCGAAGAACCTGCGCTCGTTCATGCGTATCAACTTTCTGGATGAGAGTGGCGTGGACGCTGGTGGCGTACACCGCGAGTGGTTTATGCTGgtgaacgagc
tgttggctTCGCCGACCCTCCGACTGTTTAAGTGCACCAACAAGGCTGACCAAAGCTACTTCCTCAACCCGCAGTCTCTTGCTGAGGTGGGCGAGGACCA
CCTTGCCTACTACTTTGCCACTGGACGATTGATTGGTCGCGCTCTCCTTGAAGGAGGCATTTGGGGTTTTCACCTGACGCTCCCGTTGCTGAAGGTGATC
TTGGGTATGCCAGTGACTTTCGCTGATATGGAATATCTTGACCCGGAGACGTACCGCAGTCTGCGGTGGCTGATGGACAACGATGGCGTGGATGACCTCG
GCCTTGACTTTAGTTTAACTGAACAAGTGAACGAATCCGAGAAAATAGTGGTGGACCTGATCCCGAATGGAAGGAACGTGGCCGTCACAGACGCCAACAA
GCGCGAGTACTTAAACCGCCGATTCCGCTACGTACTCTTCGAGAGTGTGGCTGACCAGATGTACGCTTTCCTGAAAGGTCTATACGAGGTCATCCCTCGT
GAGATGTTGCTGACCTTCGACCCAGAAGAATTCGACTATTTGCTCTGTGGATCCCCTGAAATCGACGTAACGGACTGGGAGGCACAAACTATAATGTCTC
CGAACCTCGAGGGAGCAAATGTAACTCGATGGTTCTGGGAGATCGTTCGTCAGATGCCGAACGAATAccgtcgacgtcttctgctgttcgcAACAGGCTC
AGCTTGCGTCCCGTTGTCGGGTTTCGGTGGCCTCACTAGCTACGATGGCCGTCTTTGCCCCTTCAACCTCAAGGGTGTGTCGTACAAAATGACCCAGTAC
ATTTCTAGCCACGCGTGCTTTAACCGGCTAGACTTACCGCTGTAtcacagcaagaaggagctgaagacgatgctgtACGCCACGCTGGACACAGATCTCA
CGGGTTTCACAACGGCATAACCCCAGATCGGCATCAACAGGTGCCGTGGTTTATCGTGGTCATGCGTCTACATGTATATCCGTCGAAGAGCAAACTATTG
TAAGCAGCTTCAAATGCTGCGATAATATTTTTGAGATTTATTGAGGATTTACTGACTGAATGGTACTCATGAACATATTTTCATGGCAATCGATCATGCA
ATGTACCGTGACCAATTGAACTTTCTAATTGAAGCAATTGTGTTTACATTTTGTGTCCTCTAGGAACGTTGACCCGGCAGAGGTGGTGATGGTTGGGGAT
GACGTTCGCCAAGACGTACACGGTGCCATGGTGTTGGGAATGCGTGGCGTGCTCGTCCAGACCGGTTCTCACGAGTTACGACGGCCGTTTCAACGGATTT
AAGCGTTAGCTCAGTAAGTGTGGCATGGAACAATTGGAGCTCAGCTTTGAGCTGGGAtcatcaaccttctccagccttctcctgtcaaTTATAGTACTAA
AAAGTAGGGTGATCCgttcgagcgagcgagctcttctcacTTTTGGTTTTACCAAGGTACAACAaggcgccttctccatcgagtttGAAAACCAAGCCGT
TCACAGCACCGCCTGGGGCAGAGCTGTGAGCGCAGCCGTCTGCGGCGGCGTATCCGACTACGTCTCGGAGAAGGTGCAAATGCGCTTAGTCGGggtagca
acagacgctacccc