Description :
From Genome Similarity Track
Location :
Scaffold_440:563- 4637
Sequence
4074 bases(100 bases per row)
CACCGTATCGATATGGTCCGTGACGATGTAGGACGCCCTTTTATGATTTCATTTGGACTATTTTATGTGAAAAGCACCAAGTTTGATTAAAAATCGACTG
ACAACCCTATCTCAGCACCAGAAATGCTTAATTCAGATGAAGCCAATGAAGCGCTAAAGCGAGAAGAGCATATAAAATCCTTACGAGCAATGGTGTCTGT
AATCTATCGCTCAGAGGAAGTCGATAGGTCAATTCGAAACGTCATAGTATGAGAGTTGACGACACCACGAGAGAAATTGCATTAAAAACATCGCTTGGTG
TGAAGTCTACAAAGGCCGAAATTTAGATACAAATCGTGAGGATTCAGGCCATAAGAAATATGTAACGGGGTTCCACGAACGGTTTTGATAACCAGGTACG
CAGGTGTGATACACACATAAAGAGATCAGTAAGACTGATAGGCGTATTATTGTATCACATACGCTAGCTGTAATACCGTACCTTATCGATTACGGATAGA
TGGTATCCATCGTAGTAGGGTTTTCATAGTACGGCGTAGTTCTGGTGTGGTAACACCAGAAGAACCCTCAGTAGGACTACTCGATTAGGTAGCATAGTTT
CAAGGTTAAATACACAAGTGAGGTTTATTATAGCTATAAATCAGTAAATAAATTCAGTTCCCCTTTTTATCAATCTAAGACACGTGTTTTGCTAAGACGT
CTTTGGTCGTAGGAGTCAGTAGCCTGTATTAAGGCTAGTAATCTTGAGCATTGGTGCCGCGTCATTTCCTTGGAGTCGTCAGTCCCCTGAACCAGGACTA
GGAGCTTGCAAGCTTGTTTCGATACTTAGAGGTAAGTCTCATTAAGTCTGCGAAGACTAGAGACCTTTTAAGCTTAGACCCGTTTAGTTGAATAGACTAA
GAGACTCTACGAGTCTATAAGTCTTCCTATGGCTAAGGTGTGAGAGTTGCTCCTCCACACTTGGTAGCACTTGTAGTCAATACCTGAGTCTGGCAAAGAA
TAGATCTTCGCAAGGATGGAAACAAAGATAAACCTTTCCACGGCCCAACAACTAACATTGGAGAAACTCAGAGCGCTAGTCGGGAACGAACAACCGGATT
TAATCCTCGCACAAGGTCCTGACTTGATTCGTACACGCATTGACGCTTTCATGCAGTTTGAGTCCACTTTAATTGTGCAACTGCACGACCATCTGGCATC
AGCTATGCCTACTCGGTAAGTCCCAATACCAGATGAAGAGCCAAGGGCTCGCCCACTTTTCCTGAGCGTGAAGCCATGTGCAAGAAAAGAAGGGGGGTTC
CTTCTGTGGATCAGAGAGGTAGAAATGACCATGAACTCCACTATGCTCCAATCGGATATCTCAAAATTTGATGGTCGGACCAGAGAATGGGTTTCAACCT
GTAGTACGTCTGTGGACGAGGCTTTTCCATATGTTTTCTTATGAATCAACAAATATACCGAGTGTTTGCTCCGCCTAATCAGGTATTTTGCATGCGTTCT
CGGATTCTATCTGCCCGCCAGGGCAGGAAAGAACTATCGGACTATGTCCAGGAGCTGAGAATTTTAATTGATGCTATGCAGATTGATCCCTTCCCAGAAA
TGGTTCTGGTTACCATCTTCATGGAGGGCCTTCGTACTGGCGTGACTCGAACGAAGTATTCCAAGTACACCACGCTTCGGTTGAGGCAGCTGTTGACATC
GCGCTGTTCGCTGAGTTTAACTTTAAGGCCGACCGCTTGGGCATAACCCAAACTCGGTGAACTCATTTGTTCATCCAATAAGCCGGAGTCTATGGACCTT
TGTCTCGCCGAGACGGATGAAGAAGCAGAGCTTCTAGATGTAAAAGAACATCGTAATACTCGGCGATGTTTCACGTGCGGAAGCATAAATAATCTGCACC
CTAATTGTCCTTTACTTAAAACAGGTCAGGATTCTTCGAGCCAGACTCTCGTCGTCTGGTACGACGCGGGAAAACGTGGACTTCCAGAAGGCTCGGGGCG
CCCGTCTAGAGAAGAAATAGCCTCTAGGAGGTAGTGGTGAACAGAACTTAGCCCCAAAGAGTTTTTTGCACTCTAACACAGGACGAGAATACAATCCATG
CTTCTTGGTCACGAAAGCGAATGTTAAGGGCTTTGAGAAGCCCTGGTCAATTCTGAGGGACTCCGGTGCATCCGGTAATTATGTAAGACGCTGTTCCCTT
GATGGTAATCAATGTTATGCTGAGGCGCTACAAGCACAAATAAGTGATACGATCACTGTCCGCTTAGCGACAAGGACTCTATTCACCGTACCCAAAGTTC
CTGTGAACTTGAATGTGAAGTTTACGATTTCGATAGTATCGAACACTGTTTAGTTCTTGCTTTGATTTGTGATATGATCTCATTCTTGGGATGATCTGGA
TTGAGCACCGCGAACCATGGGTTGATCGGTGATCAACAACATTAGGCGCAACGCGCACTGCCCTCGGAGCTTTGGAGAGTCATGAACCCACCTCTGCTAG
GAATCAGAAGTGCTATTGGCACGAAACTATTGCTGAGAATGTCAGTGTGTTGGAAATCGGAATGTCGGAACTAGTTGATTCTGACGATGTTAAAGACACG
AGTATTGAGCAAAGCTCGTTATGTGATAGTGAAACGTCACGTACTCCGTTGAGTTATATTCGTTGTGGGAACAAAGTACTGCATGCTGAAAGCATTGTTG
ACCAAGCGTTAAGTTATCGAGGGTTGGAACCATCAGATGAACATGGAGTGGCACGACTGTACCTACTGTGTGACGTCGGCTGTGATAGAGACGCGCTGAA
TGTCAATGTTGACGTTGTTGGTGAAATACTAAGGCATCCATAGCCCGGCTCAGCGGATGCGCGTGAAAAGGCACGTAATCTACGTGATAACGAGATTGAG
CCAAATGACTCGTCATCGGATGTCGGTAGTGACATCAGATTAATGCAGAGCAAATTCAGATTGATGATGATACCAATCCAGAAGAGCGTTACTACGACAT
CTTGCGGACGTTCAGACTTACCTCCAGTGGCTACGTCGGGCCACGAAGCGTGTGTTATGTCACAAAGTGATAATGACGTCCAGCTGTCAACACTCTTTAA
CGGAGTGACCAGTACCTAGGATGGTACGGCTAGTCTTGAGGATATACCCTCGCTAGGCGCCTTGCTATAAATCGAAGCGGTGTCAGTCAATAAGTTTAGT
TACTCACTATAGAATAGCTACCTTTCAGAAATGGTAATTATTTGAGCCGAAATCTTTAAGTCGAACTCTTCTTCGCTTCTGGAAGAAGCCGTTCTCGAAG
ACACAAAAGCGGCACTCAGTGCACGTAGTGGATCATCGATACTGAATAATCCTCATGGTCCCTTTTATCCTTTGGTCAAGAAATTTCTAGATGTTGAGTG
TCACGACCCACCGTCTGTTTTACCTCCCGATAGGGGTGTCCGTCATGAAATTAACTTGGTTCCTAGGACCAAGTACTGCATTACACGACAGTGACAATTG
CCAAAGGAACAACGTGACATCATTGATGACTCCTTTCGTGCCAAGCATGAGGCAGGAATGGTACGTGAGAATAAATCTGCACATTCGGCACCGACATTTG
TGTCAAAAAGCTGAACGGCAAGTGGCACATTGTTCATGCTTACAACAAGCTTAATGCGACCACCATACCGGCACAAACACCAATTCCTAGAAAAAATGTT
CTTTAGTAGAACATAGTTGATTGTATTATGTATTGTGCACTCGACTTAGTCTATGGATATTAACAATTGCTCATGCGAGCGAGTGATTTTCCGCTGACGG
CCGTGAGCACTCCAAGTAGTATGCTATGGGAATGGTTGGCGCTGCCATAAGGGCTATCTAACATGACGGCTACATTTAATCGTCGAGTGACGTAACTTTT
TCGTCCCCATCGGGATTAAGCACAGACGTACTTTGATGACTTTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGATGTTGAAAATCACATTGGTCAT
TTGCAAGCCTTGCTTGAGTGCATGCGCACTAATACATTGTGCGCCAACGCGTCTAAATGCACTTTTGGTGCAGA