Description :
From Genome Similarity Track
Location :
Scaffold_1385:563- 3264
Transcript NameFunction/comments
Phyta_totarag12847hypothetical protein

Sequence
2701 bases(100 bases per row)
TGTATTGTCGAGCGGATTCATCAGCTTGCTAATCATCGACTCCGATTGCTTGTCGACGTATGCGTAGACGCCATATCTAGAACGATCGTCTCGTACCAGG
TTTAAAACCGGCGAGCGCTCTAGTTTAACATATTCTCCACAGTCCCCGGGAGCTAGTCTGCGGACTTAGTGGGGTTGAACCACTAGCAGATCAAGTGGTA
AAACTCCTCGATTGGGCACTGGCTAGCGTCGTGGATCTCGCCACAACCCTTGCACACAAAAAAATATCGATCGGACGGATGGCCCTTTTGAtcgcacttc
ttgcaggtTGAACGTCCCCAGCATCCAAGATCGTTGTGCTCACGCTACCCGCAGTGAGAGCAGCTCTTGAACGGCGACCTCATATCGGTTGATACATAGT
GCCGATCTTGGCGGTGGGCACGGTCTCTGTGACCTGTACGGTCACGATCTTGATTCGGTGGTCCATGGTCTTGCGGTTAGCTAGGTTtaccagctgctgc
aaagcacTCTCTGCGCAATTCAGCTTCGCTGTCGGACCTGCTCAACTTCACTGTCGTCTTACTACTGTCGTCGACAATATGGGTCGCGCGTACTGAACGC
ACGGCGGCTGACGGTGTAGTTGCGACCGCTGCCTTCGTCCGAGGCTTGATCGATCTATAGACGGCCTTGCTCTAGCGTGCCTTCGCACATTGCCGAGGTC
GAAGCGTTTCATCCATGCTATCAGCGACTGGAATCCACAGCAACGCGAGTGTATCGGCAGATCACGATCGTCAAACGTCTCAATGAAGTGTCAAAACGCT
CGCGATGAGTCTCTGACTATCCGTCCTTTACCTGGAGGCGCGTACGGAGGCCAGCCACGTTGAGGCGATGCAGGTATTCCAGTTGCGACGCATTCGATCG
CATCCTTGCATGGTAGTACTATCTCGTGACATATACCCCCCGGCCGCGATACTGTGTTGGGAAGCTCTGGCGAAGATCCTTCCAGGTACTGCGAGTCGTA
CAGTTGAGTTGGCGGTACCGATTTCAGGCAGGCCCAGATAGAAGGTCGCCGAAGACCAGACCCTTCTCGTCATCAGACACTTGATCTCGCTTGAAGACCG
ACTTTACTTTGCCAATCCAGGACCAGGCtcgatcttcgtcgccatcctTTCCACTGAACTCTTTCAGCTCGGGCATCACAGACACGCGGTTACGTGGAGG
ActgtcgatcttcttgcctGTGAAGTCGCTGTCGTAGCAACTGCTGCCTGCGCAGTCGTGGCAAGATCGAGATCGTCGGGATCGTATTCCCATGACAAGG
TGTGGTGATCTGGCGATCCAACCGACTCTATATCCacgtcttgatctccagtcggTCTTGCGACACGTTGGCGGGGAGTGGGCTGCTGTTCATTCAGGAA
GCGTCCCATCGCAGCTTGAAAGTACGACTCCAACCTCTCAGGTGAGTGTCGCATCAGGATCACGGCTATGATCTCGTTTATGAAAAATAAGCTACTGCTT
CACATTCCGCTAGTTCAGCTCGACCTCGCAGCATATCGACACCAGATGGTCCCAGTGGCATTCGCGGCGGACCACCGACGCTGTCCGAGCGCACTGCTTC
GGCCGCCGGCTCGTAGTGCGACGACGTGgcagtcgtcgtccgagtgGGTGTCGGATGGAATCATGCAGCCTCCTTGGTGCATTGGCTGACCTTGGCAGCC
AGCGGCTCCAGAATCTCAAAGAAGGGCTTGAGCGTATGCTCGATCACCCCAAGGTTCAGATCAAAGCGATCATCTGCCTCGAACGCACCGGCGACGATCC
CAACCTCCTTCAGTAGCCGAAGCAACGCCTTTACCGAGTCCGGCTAGCTTGACTCTGCGGCCAGTTCCGACACAGGACCCCTGAAATTACCGAGAATGCT
TGATCGGAGAACCAGCATCACTGGGTTCTGGATCAAGAAGGCATgcaagttcttcttgtagtaTGCAGCTTTCAGCTGCTTTTCGGTCCAGGCTGGCGCA
AGATCGCCGCGACCTCCTACGTCGGAGTCCGgagccttcatcttctcccGCGAGGGCTTCGATCTCGCAGACTTCTTCGTAGCGCTCAATCTTGAGCCAA
CGAGTTGGTCGGATTGACAACCTTCAGCTTTCGCTGGTGGTCCTTCATCCGGCGGATTCCGATTCGCATCGAGTTCTGATGGGATCCCCGGGGGTCCTGG
GGAGGAGGTTGTGGTTTATCTTTCGAGTTCGTCGCCGGTATGGCCTCTGTACCGTCGGTAGAGCTCCTCTCCAACCGCTGCTGACTCGCGGATCGATCTT
GAGTTAGGATCGTCGTCGGTTATCCGACCTCCGTCGACGCTTGCTTCTCATATCCATTTTCAGATTGTGCTTCCTCGTGGAGGGACTCACCGTGAGATCC
CGAGTCACCCAAAGCTCCGGGCACGCGCATCGTTGTGGTGAATTGGGTCCGCGAAAATGACTGGTCGCGGGGTCCTCTTGCACAGGACGCTGAGCCATCG
ACCgacggagggggtactccgatatccgttggattgctcaccttgtgtacccgtcggtagggctgggTCAGTCTTCGGGTGCACTCGGAGGAAACATTTG
GGTTGATCTTGAACTGCATAGGCCGGACAGCGAGAACTTGTGACAGCAGCGCGGAATGTTCTTCACACTGTGTcattggggggggggggtcttgAAATGA
G