Description :
From Genome Similarity Track
Location :
Scaffold_43:56299- 58785
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.45Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_43-fgenesh-gene-0.22NOL1/NOP2/Sun family protein

Sequence
2486 bases(100 bases per row)
GTCGACTTCCGTGATCGGCACAGACGTGATGATGTCCTTGTAGGAGAGGCATTCTGGCTGCAAGTCAACGAGACGTACCTCCACGTTGACGACGACGATG
AGGTCCTATCACTTTTGGTTGATACGCACTATTATCTcGGATGTCCTGGATGGGTGGAGGACCCGGAGCGTGAAGGAAGTACTCTTCCAGTTCTCGGTGC
AGCCACCAAATACGTGAAGAAAGACCGTGATCCGGCACGTATTTTCAAGCTCGTGGCGATGAAAGCCATGGTGCCAGCAAGCTCTTACTATGGGGATGAC
CGAGCTACTCGCGAGTTCGCACTCGAAACCAACCAAAACATCTTGCGATTGGCGACGTGGCGTTTCAAGTCAGCAAAAGCAGACGAAGGCAGTGAAACAA
CTGGTTTGGTACTGAACTGCAGCTCCATTGTGCTCCAACAGGGCGAGTTTCCACTTGAATTTGATCAAAGACGACGACGTGGCGTACTTCGAGGCGAAGT
AAAACAGAGCCATTCTGCTGGTCATGATCAGCACCTTCGTGAGTCGTGCACTTGGCAAGTTCGTCTTGTTCGAAGAGGTGCTTCAGACGCTGAAGAAGCC
ACTGTGACCAAAGCACTCAGAAGCCCAGGACGTCGCCCACATCTGCATCTGGGCGAAAGAGAATCGCTGGAGTGGCTTCAGCATCACCAAGAGCTAGTAG
AAGACGAaCGGAAACGATTGAGTGAGAAGATGAGGCTGGCACACAACTCGAAACGCGCCTTTAACCGCATAATCGCCAAGATTAACAACACACTTGCTCT
CATTGAACACAATAAGGCACTCGATCAGCATGCGTACTTCCAGAGCAGGTACAACGAGATGGTTAATGAAGGTTTCGACAAACTCCCAGCGTTGCGAATC
ACATGAAACGAAGGCGTCTATTACTTTGTGTCATTCTGCGGCTGAGACTCGAGTTTTTGCTGCTTCTTTCGCTTCAGCTTCTCCTTCTTCCGCCTCTTGC
GGGACTCTTTTTGTGCATCCGACAACTGCTTGCGCTTTtCCCcTACGCAACCGGTTCCTTCATCATTCTCGTCGTCGCTTTCGTCCTTGTCGTTCGATGG
ATGGTGgTCATCATCAATaTCACTGGCTGCCGCGCTCGCATCTCGCTCGAAGTATGCGACAAaGAAGCCGTTTGTGTTGTCTTCATGGCcGTCTGCTCGA
ACTAACGCGTCCGCCTCTTCAGCCTTCAGTCCAGCAACCTGCAACCCACGACGTGGCCACGTCGGCAGACACTTTCGCAGGACGAAAGGACGCTTATCCT
TGCGATTTTGGGTCGACTTGAGCGCGGCTGCCACCACCTCTTCATTCTCCTTCTGGAAGATGGAGCACGTAGAGTACGAGACGCGCTCGACTTGAGGAAA
CGaGAAGGCCTTCAAGAGCGCTTCAAGTTGGAAGTCCGCAAGCGACTGGAGACGTGCAGCGACTTCGTCGGCGTCACCTCCTGCTGCCACGTCGTtCTCG
TTCTCTTGTTCCGTGGTCGAGGAAGAGCTCGCGATGTCGAGCAAGTGATCGAGGCGGTTGGTCATACCGGAaCCAGAGCACGATGGATCGAGCAGAATCG
CCCGCACATTGGCATACTTGGGGTCGTTCACGTCCACTTCGAGGAAACTCTGCAGACACGCTTCCACGaGGgTGTCTGCTCCCGCGAGCTTCATACGTCG
CTTCAACAAATCCAAGCGCTTGGCGGATCGGTCGAACGCAAAGACGCGTCGCTGCTGCGTGGTCTCACTCTGTCGCTGATGGAGAAGCATCGCGGCGTGG
CTCGTCTtGTTTCCTGGAGCTGCACACGCGTCGATCACGTCGCCTTCGTTGCCTTCCGTATCGGTACGCTCTCCATGGAGAaCGAAGgCCGgAAaGCAAC
TCGCCTTGTCTTGCAGTATGAGCTTGCCCGTCTTCACGAGCTCGTGCTCATGCAGCTCAGTGCCTGgTGGgAGCACGAGGAGATCTTTCACATGCTCGTC
TTCGGTGGCCTCTGCATGTTCACTTCGAAACGCCGCCACTTCTTCGTCCGAGATCTTGAGTGTGTTGACACGCACGTAGCGCGGTAACAGCAGCTCGACC
TTGCGGTTTTCCTTGGGCAGTAGCAGCTCGTTCGTCGCGACTTTGGCCTTGATCTTGAGGCGCACCAGTGCCGTTTTGAAGGCATTGGCGAACTGCATGA
GCTCCTTCTTCATGTGCCCACCACCTTGAATCTTCTGCCGACCAAACAGCAAATCGTAGAGCGAGATCAGCAGCAGTGCACGCTGCGCGCCGCCCTTGAG
CTTCTTCTGCATCTTGAACTGGGgCACGGTGGCCAGGAGCTGCTCCAGCAGGGGCTTGAAGCGCAGCGTCTCGCACACCAGCGCGAACGACGAGCGCTTG
TGCTGCACATTCTCAGCATACGCGAGGCTCTTGAGCCCGCCCTCGCGACGCTCCAGCTTCTGCAGCAGCTCTGCCGCTTCCTTGTA